EMAIL THIS PAGE TO A FRIEND

LEPROT

leptin receptor overlapping transcript

119 Gene Product Result for
Synonyms: LEPR OB-RGRP OBRGRP VPS55
UniProtKB ID: O15243, Q6FHL5
Gene ID:
Human(54741) Summary: LEPROT is associated with the Golgi complex and endosomes and has a role in cell surface expression of growth hormone receptor (GHR; MIM 600946) and leptin receptor (OBR, or LEPR; MIM 601007), thereby altering receptor-mediated cell signaling (Couturier et al., 2007 [PubMed 18042720]
Mouse(230514) leptin receptor overlapping transcript
Rat(56766) leptin receptor overlapping transcript
chicken(424699) leptin receptor overlapping transcript
cow(613665) leptin receptor overlapping transcript
domestic cat(101085391) leptin receptor overlapping transcript
dog(609115) leptin receptor overlapping transcript
domestic guinea pig(100720928) leptin receptor overlapping transcript
naked mole-rat(101706569) leptin receptor overlapping transcript
sheep(101111500) leptin receptor overlapping transcript
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA069444 Anti-LEPROT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017526 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175036 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175036 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175036 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067151 MISSION® esiRNA esiRNA targeting mouse Leprot (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017526 Rosetta Predictions human pricing
NM_020099 Rosetta Predictions rat pricing
NM_175036 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114646 predicted 659
2 SASI_Hs01_00114647 predicted 347
3 SASI_Hs01_00114648 predicted 264
4 SASI_Hs01_00114649 predicted 623
5 SASI_Hs01_00114650 predicted 602
6 SASI_Hs01_00114651 predicted 410
7 SASI_Hs01_00114652 predicted 380
8 SASI_Hs02_00350148 predicted 651
9 SASI_Hs01_00114653 predicted 516
10 SASI_Hs01_00114654 predicted 481
11 SASI_Hs01_00114655 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033642 predicted 686
2 SASI_Rn01_00033643 predicted 425
3 SASI_Rn01_00033644 predicted 384
4 SASI_Rn01_00033645 predicted 434
5 SASI_Rn01_00033646 predicted 651
6 SASI_Rn01_00033647 predicted 243
7 SASI_Rn01_00033648 predicted 431
8 SASI_Rn01_00033649 predicted 730
9 SASI_Rn02_00262508 predicted 584
10 SASI_Rn01_00033650 predicted 589
11 SASI_Rn01_00033641 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175036 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186989 predicted 323
2 SASI_Mm01_00186990 predicted 219
3 SASI_Mm01_00186991 predicted 777
4 SASI_Mm01_00186994 predicted 765
5 SASI_Mm01_00186992 predicted 886
6 SASI_Mm01_00186993 predicted 887
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017526
VALIDATED
LEPROT MISSION shRNA Bacterial Glycerol Stock
leptin receptor overlapping transcript
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-189s21c1
Sequence:CCGGTGGCCCTTATTCGTCCTGATTCTCGAGAATCAGGACGAATAAGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-330s1c1
Sequence:CCGGGCCTTTGGATTTCCTGTTATTCTCGAGAATAACAGGAAATCCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-166s1c1
Sequence:CCGGCCTTAGAGGATTATGGCGTTTCTCGAGAAACGCCATAATCCTCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017526.2-189s1c1
Sequence:CCGGTGGCCCTTATTCGTCCTGATTCTCGAGAATCAGGACGAATAAGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-307s1c1
Sequence:CCGGTCACTACTGGAATTGTTGTTTCTCGAGAAACAACAATTCCAGTAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-441s1c1
Sequence:CCGGCTTATATTTGGAAGAGGAGATCTCGAGATCTCCTCTTCCAAATATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017526.3-987s21c1
Sequence:CCGGAGACCAAGAGCCTCAACATTTCTCGAGAAATGTTGAGGCTCTTGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.3-552s21c1
Sequence:CCGGGGTAGCACTTTATTCTGATTACTCGAGTAATCAGAATAAAGTGCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-307s21c1
Sequence:CCGGTCACTACTGGAATTGTTGTTTCTCGAGAAACAACAATTCCAGTAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017526.2-657s21c1
Sequence:CCGGGCAAATAGACCTGTCAAATTTCTCGAGAAATTTGACAGGTCTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-285s21c1
Sequence:CCGGTGTCGGGAACTGGCATATTTCCTCGAGGAAATATGCCAGTTCCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-330s21c1
Sequence:CCGGGCCTTTGGATTTCCTGTTATTCTCGAGAATAACAGGAAATCCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017526
VALIDATED
LEPROT MISSION shRNA shRNA Plasmid DNA
leptin receptor overlapping transcript
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-189s21c1
Sequence:CCGGTGGCCCTTATTCGTCCTGATTCTCGAGAATCAGGACGAATAAGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-330s1c1
Sequence:CCGGGCCTTTGGATTTCCTGTTATTCTCGAGAATAACAGGAAATCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-166s1c1
Sequence:CCGGCCTTAGAGGATTATGGCGTTTCTCGAGAAACGCCATAATCCTCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017526.2-189s1c1
Sequence:CCGGTGGCCCTTATTCGTCCTGATTCTCGAGAATCAGGACGAATAAGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-307s1c1
Sequence:CCGGTCACTACTGGAATTGTTGTTTCTCGAGAAACAACAATTCCAGTAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-441s1c1
Sequence:CCGGCTTATATTTGGAAGAGGAGATCTCGAGATCTCCTCTTCCAAATATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017526.3-987s21c1
Sequence:CCGGAGACCAAGAGCCTCAACATTTCTCGAGAAATGTTGAGGCTCTTGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.3-552s21c1
Sequence:CCGGGGTAGCACTTTATTCTGATTACTCGAGTAATCAGAATAAAGTGCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-307s21c1
Sequence:CCGGTCACTACTGGAATTGTTGTTTCTCGAGAAACAACAATTCCAGTAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017526.2-657s21c1
Sequence:CCGGGCAAATAGACCTGTCAAATTTCTCGAGAAATTTGACAGGTCTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-285s21c1
Sequence:CCGGTGTCGGGAACTGGCATATTTCCTCGAGGAAATATGCCAGTTCCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-330s21c1
Sequence:CCGGGCCTTTGGATTTCCTGTTATTCTCGAGAATAACAGGAAATCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017526
VALIDATED
LEPROT MISSION shRNA Lentiviral Transduction Particles
leptin receptor overlapping transcript
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-189s21c1
Sequence:CCGGTGGCCCTTATTCGTCCTGATTCTCGAGAATCAGGACGAATAAGGGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-330s1c1
Sequence:CCGGGCCTTTGGATTTCCTGTTATTCTCGAGAATAACAGGAAATCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-166s1c1
Sequence:CCGGCCTTAGAGGATTATGGCGTTTCTCGAGAAACGCCATAATCCTCTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017526.2-189s1c1
Sequence:CCGGTGGCCCTTATTCGTCCTGATTCTCGAGAATCAGGACGAATAAGGGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-307s1c1
Sequence:CCGGTCACTACTGGAATTGTTGTTTCTCGAGAAACAACAATTCCAGTAGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017526.2-441s1c1
Sequence:CCGGCTTATATTTGGAAGAGGAGATCTCGAGATCTCCTCTTCCAAATATAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017526.3-987s21c1
Sequence:CCGGAGACCAAGAGCCTCAACATTTCTCGAGAAATGTTGAGGCTCTTGGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.3-552s21c1
Sequence:CCGGGGTAGCACTTTATTCTGATTACTCGAGTAATCAGAATAAAGTGCTACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-307s21c1
Sequence:CCGGTCACTACTGGAATTGTTGTTTCTCGAGAAACAACAATTCCAGTAGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017526.2-657s21c1
Sequence:CCGGGCAAATAGACCTGTCAAATTTCTCGAGAAATTTGACAGGTCTATTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-285s21c1
Sequence:CCGGTGTCGGGAACTGGCATATTTCCTCGAGGAAATATGCCAGTTCCCGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017526.2-330s21c1
Sequence:CCGGGCCTTTGGATTTCCTGTTATTCTCGAGAATAACAGGAAATCCAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175036
VALIDATED
LEPROT MISSION shRNA Bacterial Glycerol Stock
leptin receptor overlapping transcript
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-238s1c1
Sequence:CCGGGTATTTCTTCACCACTGGGATCTCGAGATCCCAGTGGTGAAGAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-390s1c1
Sequence:CCGGGAAGAGGAGATGATTTCAGTTCTCGAGAACTGAAATCATCTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-597s1c1
Sequence:CCGGCCATTGACTCAAAGTGAATTACTCGAGTAATTCACTTTGAGTCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-358s1c1
Sequence:CCGGCCTCACAATTCAAGGCTTCTTCTCGAGAAGAAGCCTTGAATTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-1174s1c1
Sequence:CCGGGCTGGAATGGTCCCTACTTTACTCGAGTAAAGTAGGGACCATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175036.4-596s21c1
Sequence:CCGGCCATTGACTCAAAGTGAATTACTCGAGTAATTCACTTTGAGTCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-389s21c1
Sequence:CCGGGAAGAGGAGATGATTTCAGTTCTCGAGAACTGAAATCATCTCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-237s21c1
Sequence:CCGGGTATTTCTTCACCACTGGGATCTCGAGATCCCAGTGGTGAAGAAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-357s21c1
Sequence:CCGGCCTCACAATTCAAGGCTTCTTCTCGAGAAGAAGCCTTGAATTGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175036
VALIDATED
LEPROT MISSION shRNA shRNA Plasmid DNA
leptin receptor overlapping transcript
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-238s1c1
Sequence:CCGGGTATTTCTTCACCACTGGGATCTCGAGATCCCAGTGGTGAAGAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-390s1c1
Sequence:CCGGGAAGAGGAGATGATTTCAGTTCTCGAGAACTGAAATCATCTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-597s1c1
Sequence:CCGGCCATTGACTCAAAGTGAATTACTCGAGTAATTCACTTTGAGTCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-358s1c1
Sequence:CCGGCCTCACAATTCAAGGCTTCTTCTCGAGAAGAAGCCTTGAATTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-1174s1c1
Sequence:CCGGGCTGGAATGGTCCCTACTTTACTCGAGTAAAGTAGGGACCATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175036.4-596s21c1
Sequence:CCGGCCATTGACTCAAAGTGAATTACTCGAGTAATTCACTTTGAGTCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-389s21c1
Sequence:CCGGGAAGAGGAGATGATTTCAGTTCTCGAGAACTGAAATCATCTCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-237s21c1
Sequence:CCGGGTATTTCTTCACCACTGGGATCTCGAGATCCCAGTGGTGAAGAAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-357s21c1
Sequence:CCGGCCTCACAATTCAAGGCTTCTTCTCGAGAAGAAGCCTTGAATTGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175036
VALIDATED
LEPROT MISSION shRNA Lentiviral Transduction Particles
leptin receptor overlapping transcript
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-238s1c1
Sequence:CCGGGTATTTCTTCACCACTGGGATCTCGAGATCCCAGTGGTGAAGAAATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-390s1c1
Sequence:CCGGGAAGAGGAGATGATTTCAGTTCTCGAGAACTGAAATCATCTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-597s1c1
Sequence:CCGGCCATTGACTCAAAGTGAATTACTCGAGTAATTCACTTTGAGTCAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-358s1c1
Sequence:CCGGCCTCACAATTCAAGGCTTCTTCTCGAGAAGAAGCCTTGAATTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175036.2-1174s1c1
Sequence:CCGGGCTGGAATGGTCCCTACTTTACTCGAGTAAAGTAGGGACCATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175036.4-596s21c1
Sequence:CCGGCCATTGACTCAAAGTGAATTACTCGAGTAATTCACTTTGAGTCAATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-389s21c1
Sequence:CCGGGAAGAGGAGATGATTTCAGTTCTCGAGAACTGAAATCATCTCCTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-237s21c1
Sequence:CCGGGTATTTCTTCACCACTGGGATCTCGAGATCCCAGTGGTGAAGAAATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175036.4-357s21c1
Sequence:CCGGCCTCACAATTCAAGGCTTCTTCTCGAGAAGAAGCCTTGAATTGTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)