EMAIL THIS PAGE TO A FRIEND

LEPROTL1

leptin receptor overlapping transcript-like 1

195 Gene Product Result for
Synonyms: HSPC112 Vps55 my047
UniProtKB ID: O95214, E9PHP8, Q9BW48
Gene ID:
Mouse(68192) leptin receptor overlapping transcript-like 1
Rat(361160) leptin receptor overlapping transcript-like 1
Goat(100861093) leptin receptor overlapping transcript-like 1
sheep(101104039) leptin receptor overlapping transcript-like 1
domestic guinea pig(100728007) leptin receptor overlapping transcript-like 1
naked mole-rat(101721466) leptin receptor overlapping transcript-like 1
chicken(422625) leptin receptor overlapping transcript-like 1
cow(513036) leptin receptor overlapping transcript-like 1
domestic cat(101093431) leptin receptor overlapping transcript-like 1
dog(475601) leptin receptor overlapping transcript-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128208 Rosetta Predictions human pricing
NM_015344 Rosetta Predictions human pricing
NM_001013188 Rosetta Predictions rat pricing
NM_026609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330826 predicted 299
2 SASI_Hs02_00330827 predicted 325
3 SASI_Hs02_00330828 predicted 353
4 SASI_Hs02_00330829 predicted 255
5 SASI_Hs02_00330830 predicted 286
6 SASI_Hs02_00330831 predicted 265
7 SASI_Hs02_00330832 predicted 473
8 SASI_Hs02_00330833 predicted 332
9 SASI_Hs02_00330834 predicted 233
10 SASI_Hs02_00330835 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056120 predicted 308
2 SASI_Hs01_00056121 predicted 502
3 SASI_Hs01_00056122 predicted 419
4 SASI_Hs01_00056123 predicted 304
5 SASI_Hs01_00056124 predicted 286
6 SASI_Hs01_00056125 predicted 572
7 SASI_Hs01_00056126 predicted 714
8 SASI_Hs01_00056127 predicted 113
9 SASI_Hs01_00056128 predicted 535
10 SASI_Hs01_00056129 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046688 predicted 305
2 SASI_Rn01_00046689 predicted 381
3 SASI_Rn01_00046690 predicted 249
4 SASI_Rn01_00046692 predicted 384
5 SASI_Rn01_00046693 predicted 236
6 SASI_Rn01_00046694 predicted 358
7 SASI_Rn01_00046695 predicted 353
8 SASI_Rn01_00046696 predicted 281
9 SASI_Rn02_00200949 predicted 413
10 SASI_Rn02_00200950 predicted 315
11 SASI_Rn01_00046691 predicted 249
12 SASI_Rn01_00046697 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092076 predicted 353
2 SASI_Mm01_00092077 predicted 919
3 SASI_Mm01_00092079 predicted 741
4 SASI_Mm01_00092080 predicted 721
5 SASI_Mm01_00092081 predicted 41
6 SASI_Mm01_00092082 predicted 223
7 SASI_Mm01_00092083 predicted 787
8 SASI_Mm02_00330569 predicted 184
9 SASI_Mm01_00092084 predicted 436
10 SASI_Mm01_00092085 predicted 539
11 SASI_Mm01_00092078 predicted 776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015344
LEPROTL1 MISSION shRNA Bacterial Glycerol Stock
leptin receptor overlapping transcript-like 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-332s21c1
Sequence:CCGGGGGCATTGTCGTGTCAGCTTTCTCGAGAAAGCTGACACGACAATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-304s21c1
Sequence:CCGGGTAAGGAACTTGCCATCTTTCCTCGAGGAAAGATGGCAAGTTCCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015344.2-743s21c1
Sequence:CCGGTGTGGTGTCCTGCTGAATTTACTCGAGTAAATTCAGCAGGACACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-352s21c1
Sequence:CCGGTTGGACTCCCTATTGTATTTGCTCGAGCAAATACAATAGGGAGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-467s21c1
Sequence:CCGGTGGAAGCAATGACGACTTCAGCTCGAGCTGAAGTCGTCATTGCTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015344.2-578s21c1
Sequence:CCGGAGTTAATGCTGAATGGTATAGCTCGAGCTATACCATTCAGCATTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-265s21c1
Sequence:CCGGGAAGATTAGTGGATGATACAGCTCGAGCTGTATCATCCACTAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-426s21c1
Sequence:CCGGACAGTCATCTTTGCAACTATACTCGAGTATAGTTGCAAAGATGACTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-227s1c1
Sequence:CCGGCATACTGCATAGCAAGAAGATCTCGAGATCTTCTTGCTATGCAGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-350s1c1
Sequence:CCGGCCAGAGCACATCTGATTGAGTCTCGAGACTCAATCAGATGTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-441s1c1
Sequence:CCGGCTTTGGAAGCAAGGACGACTTCTCGAGAAGTCGTCCTTGCTTCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-210s1c1
Sequence:CCGGCATCCTTTCACCTATTCCATACTCGAGTATGGAATAGGTGAAAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-294s1c1
Sequence:CCGGCATCTTTCTTACAACGGGCATCTCGAGATGCCCGTTGTAAGAAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015344
LEPROTL1 MISSION shRNA shRNA Plasmid DNA
leptin receptor overlapping transcript-like 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-332s21c1
Sequence:CCGGGGGCATTGTCGTGTCAGCTTTCTCGAGAAAGCTGACACGACAATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-304s21c1
Sequence:CCGGGTAAGGAACTTGCCATCTTTCCTCGAGGAAAGATGGCAAGTTCCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015344.2-743s21c1
Sequence:CCGGTGTGGTGTCCTGCTGAATTTACTCGAGTAAATTCAGCAGGACACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-352s21c1
Sequence:CCGGTTGGACTCCCTATTGTATTTGCTCGAGCAAATACAATAGGGAGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-467s21c1
Sequence:CCGGTGGAAGCAATGACGACTTCAGCTCGAGCTGAAGTCGTCATTGCTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015344.2-578s21c1
Sequence:CCGGAGTTAATGCTGAATGGTATAGCTCGAGCTATACCATTCAGCATTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-265s21c1
Sequence:CCGGGAAGATTAGTGGATGATACAGCTCGAGCTGTATCATCCACTAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-426s21c1
Sequence:CCGGACAGTCATCTTTGCAACTATACTCGAGTATAGTTGCAAAGATGACTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-227s1c1
Sequence:CCGGCATACTGCATAGCAAGAAGATCTCGAGATCTTCTTGCTATGCAGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-350s1c1
Sequence:CCGGCCAGAGCACATCTGATTGAGTCTCGAGACTCAATCAGATGTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-441s1c1
Sequence:CCGGCTTTGGAAGCAAGGACGACTTCTCGAGAAGTCGTCCTTGCTTCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-210s1c1
Sequence:CCGGCATCCTTTCACCTATTCCATACTCGAGTATGGAATAGGTGAAAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-294s1c1
Sequence:CCGGCATCTTTCTTACAACGGGCATCTCGAGATGCCCGTTGTAAGAAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015344
LEPROTL1 MISSION shRNA Lentiviral Transduction Particles
leptin receptor overlapping transcript-like 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-332s21c1
Sequence:CCGGGGGCATTGTCGTGTCAGCTTTCTCGAGAAAGCTGACACGACAATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-304s21c1
Sequence:CCGGGTAAGGAACTTGCCATCTTTCCTCGAGGAAAGATGGCAAGTTCCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015344.2-743s21c1
Sequence:CCGGTGTGGTGTCCTGCTGAATTTACTCGAGTAAATTCAGCAGGACACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-352s21c1
Sequence:CCGGTTGGACTCCCTATTGTATTTGCTCGAGCAAATACAATAGGGAGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-467s21c1
Sequence:CCGGTGGAAGCAATGACGACTTCAGCTCGAGCTGAAGTCGTCATTGCTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015344.2-578s21c1
Sequence:CCGGAGTTAATGCTGAATGGTATAGCTCGAGCTATACCATTCAGCATTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-265s21c1
Sequence:CCGGGAAGATTAGTGGATGATACAGCTCGAGCTGTATCATCCACTAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015344.2-426s21c1
Sequence:CCGGACAGTCATCTTTGCAACTATACTCGAGTATAGTTGCAAAGATGACTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-227s1c1
Sequence:CCGGCATACTGCATAGCAAGAAGATCTCGAGATCTTCTTGCTATGCAGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-350s1c1
Sequence:CCGGCCAGAGCACATCTGATTGAGTCTCGAGACTCAATCAGATGTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-441s1c1
Sequence:CCGGCTTTGGAAGCAAGGACGACTTCTCGAGAAGTCGTCCTTGCTTCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-210s1c1
Sequence:CCGGCATCCTTTCACCTATTCCATACTCGAGTATGGAATAGGTGAAAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015344.1-294s1c1
Sequence:CCGGCATCTTTCTTACAACGGGCATCTCGAGATGCCCGTTGTAAGAAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026609
VALIDATED
LEPROTL1 MISSION shRNA Bacterial Glycerol Stock
leptin receptor overlapping transcript-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-358s21c1
Sequence:CCGGACAGTCATCTTCGCGACTATTCTCGAGAATAGTCGCGAAGATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-369s21c1
Sequence:CCGGCGCGACTATTCTAGGCTTCTTCTCGAGAAGAAGCCTAGAATAGTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026609.2-927s21c1
Sequence:CCGGGACATACCTTATCTACTATTTCTCGAGAAATAGTAGATAAGGTATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-108s21c1
Sequence:CCGGTGGATGTGCCCTTCCGATATACTCGAGTATATCGGAAGGGCACATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-234s21c1
Sequence:CCGGGTGTAAGGAGCTTGCCATATTCTCGAGAATATGGCAAGCTCCTTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026609.2-2062s1c1
Sequence:CCGGGCACCAAGTTTGTTCAGCTTTCTCGAGAAAGCTGAACAAACTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-116s1c1
Sequence:CCGGCCCTTCCGATATACAACCAATCTCGAGATTGGTTGTATATCGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-369s1c1
Sequence:CCGGCGCGACTATTCTAGGCTTCTTCTCGAGAAGAAGCCTAGAATAGTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-358s1c1
Sequence:CCGGACAGTCATCTTCGCGACTATTCTCGAGAATAGTCGCGAAGATGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026609.2-182s1c1
Sequence:CCGGCGTACTGCATAGCCAGAAGATCTCGAGATCTTCTGGCTATGCAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026609
VALIDATED
LEPROTL1 MISSION shRNA shRNA Plasmid DNA
leptin receptor overlapping transcript-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-358s21c1
Sequence:CCGGACAGTCATCTTCGCGACTATTCTCGAGAATAGTCGCGAAGATGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-369s21c1
Sequence:CCGGCGCGACTATTCTAGGCTTCTTCTCGAGAAGAAGCCTAGAATAGTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026609.2-927s21c1
Sequence:CCGGGACATACCTTATCTACTATTTCTCGAGAAATAGTAGATAAGGTATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-108s21c1
Sequence:CCGGTGGATGTGCCCTTCCGATATACTCGAGTATATCGGAAGGGCACATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-234s21c1
Sequence:CCGGGTGTAAGGAGCTTGCCATATTCTCGAGAATATGGCAAGCTCCTTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026609.2-2062s1c1
Sequence:CCGGGCACCAAGTTTGTTCAGCTTTCTCGAGAAAGCTGAACAAACTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-116s1c1
Sequence:CCGGCCCTTCCGATATACAACCAATCTCGAGATTGGTTGTATATCGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-369s1c1
Sequence:CCGGCGCGACTATTCTAGGCTTCTTCTCGAGAAGAAGCCTAGAATAGTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-358s1c1
Sequence:CCGGACAGTCATCTTCGCGACTATTCTCGAGAATAGTCGCGAAGATGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026609.2-182s1c1
Sequence:CCGGCGTACTGCATAGCCAGAAGATCTCGAGATCTTCTGGCTATGCAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026609
VALIDATED
LEPROTL1 MISSION shRNA Lentiviral Transduction Particles
leptin receptor overlapping transcript-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-358s21c1
Sequence:CCGGACAGTCATCTTCGCGACTATTCTCGAGAATAGTCGCGAAGATGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-369s21c1
Sequence:CCGGCGCGACTATTCTAGGCTTCTTCTCGAGAAGAAGCCTAGAATAGTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026609.2-927s21c1
Sequence:CCGGGACATACCTTATCTACTATTTCTCGAGAAATAGTAGATAAGGTATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-108s21c1
Sequence:CCGGTGGATGTGCCCTTCCGATATACTCGAGTATATCGGAAGGGCACATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026609.2-234s21c1
Sequence:CCGGGTGTAAGGAGCTTGCCATATTCTCGAGAATATGGCAAGCTCCTTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026609.2-2062s1c1
Sequence:CCGGGCACCAAGTTTGTTCAGCTTTCTCGAGAAAGCTGAACAAACTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-116s1c1
Sequence:CCGGCCCTTCCGATATACAACCAATCTCGAGATTGGTTGTATATCGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-369s1c1
Sequence:CCGGCGCGACTATTCTAGGCTTCTTCTCGAGAAGAAGCCTAGAATAGTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026609.2-358s1c1
Sequence:CCGGACAGTCATCTTCGCGACTATTCTCGAGAATAGTCGCGAAGATGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026609.2-182s1c1
Sequence:CCGGCGTACTGCATAGCCAGAAGATCTCGAGATCTTCTGGCTATGCAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)