EMAIL THIS PAGE TO A FRIEND

LETM1

leucine zipper-EF-hand containing transmembrane protein 1

61 Gene Product Result for
UniProtKB ID: O95202, B4DED2, Q9UF65
Gene ID:
Human(3954) Summary: This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
Mouse(56384) leucine zipper-EF-hand containing transmembrane protein 1
Rat(305457) leucine zipper-EF-hand containing transmembrane protein 1
Zebrafish(570745) leucine zipper-EF-hand containing transmembrane protein 1
domestic cat(101082904) leucine zipper-EF-hand containing transmembrane protein 1
cow(513324) leucine zipper-EF-hand containing transmembrane protein 1
Horse(100052731) leucine zipper-EF-hand containing transmembrane protein 1
dog(488807) leucine zipper-EF-hand containing transmembrane protein 1
fruit fly(37912) CG4589 gene product from transcript CG4589-RB
chicken(422898) leucine zipper-EF-hand containing transmembrane protein 1
domestic guinea pig(100722636) leucine zipper-EF-hand containing transmembrane protein 1
naked mole-rat(101710555) leucine zipper-EF-hand containing transmembrane protein 1
Domestic Rabbit(100346816) leucine zipper-EF-hand containing transmembrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012318 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012318 Rosetta Predictions human pricing
NM_001005884 Rosetta Predictions rat pricing
NM_019694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033922 predicted 3003
2 SASI_Hs02_00344092 predicted 2042
3 SASI_Hs01_00033923 predicted 2708
4 SASI_Hs01_00033924 predicted 1615
5 SASI_Hs02_00344093 predicted 1144
6 SASI_Hs01_00033926 predicted 1949
7 SASI_Hs01_00033927 predicted 988
8 SASI_Hs01_00033928 predicted 2092
9 SASI_Hs01_00033929 predicted 994
10 SASI_Hs02_00344094 predicted 1008
11 SASI_Hs01_00033925 predicted 1145
12 SASI_Hs01_00033930 predicted 1014
13 SASI_Hs01_00033931 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034862 predicted 1406
2 SASI_Rn01_00034863 predicted 792
3 SASI_Rn02_00198458 predicted 995
4 SASI_Rn02_00198459 predicted 974
5 SASI_Rn01_00034864 predicted 1526
6 SASI_Rn01_00034865 predicted 334
7 SASI_Rn01_00034867 predicted 537
8 SASI_Rn01_00034868 predicted 1756
9 SASI_Rn01_00034870 predicted 1954
10 SASI_Rn02_00198460 predicted 911
11 SASI_Rn01_00034861 predicted 1219
12 SASI_Rn01_00034866 predicted 1951
13 SASI_Rn01_00034869 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106648 predicted 989
2 SASI_Mm01_00106649 predicted 1166
3 SASI_Mm01_00106650 predicted 469
4 SASI_Mm01_00106652 predicted 743
5 SASI_Mm01_00106653 predicted 1474
6 SASI_Mm01_00106654 predicted 499
7 SASI_Mm01_00106655 predicted 1885
8 SASI_Mm01_00106656 predicted 2000
9 SASI_Mm01_00106657 predicted 1388
10 SASI_Mm02_00324791 predicted 840
11 SASI_Mm01_00106651 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019694
VALIDATED
LETM1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper-EF-hand containing transmembrane protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-327s21c1
Sequence:CCGGCCTGTGTACCTCTGCTTCAAACTCGAGTTTGAAGCAGAGGTACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-824s21c1
Sequence:CCGGGCCTGTAGTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAACTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019694.1-3035s1c1
Sequence:CCGGCGCTCTCTTGAGTTCACCATTCTCGAGAATGGTGAACTCAAGAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019694.1-1466s1c1
Sequence:CCGGCCTTCCAGAAATTGTGGCAAACTCGAGTTTGCCACAATTTCTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019694.1-327s1c1
Sequence:CCGGCCTGTGTACCTCTGCTTCAAACTCGAGTTTGAAGCAGAGGTACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019694.1-2271s1c1
Sequence:CCGGGCTGAAATTGTGGCCACACTACTCGAGTAGTGTGGCCACAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019694.1-824s1c1
Sequence:CCGGGCCTGTAGTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAACTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019694.1-2271s21c1
Sequence:CCGGGCTGAAATTGTGGCCACACTACTCGAGTAGTGTGGCCACAATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-2177s21c1
Sequence:CCGGTGATAATAAGGACGGCAATATCTCGAGATATTGCCGTCCTTATTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-2529s21c1
Sequence:CCGGTTCATCATTCCACGAAGATTCCTCGAGGAATCTTCGTGGAATGATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019694
VALIDATED
LETM1 MISSION shRNA shRNA Plasmid DNA
leucine zipper-EF-hand containing transmembrane protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-327s21c1
Sequence:CCGGCCTGTGTACCTCTGCTTCAAACTCGAGTTTGAAGCAGAGGTACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-824s21c1
Sequence:CCGGGCCTGTAGTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAACTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019694.1-3035s1c1
Sequence:CCGGCGCTCTCTTGAGTTCACCATTCTCGAGAATGGTGAACTCAAGAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019694.1-1466s1c1
Sequence:CCGGCCTTCCAGAAATTGTGGCAAACTCGAGTTTGCCACAATTTCTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019694.1-327s1c1
Sequence:CCGGCCTGTGTACCTCTGCTTCAAACTCGAGTTTGAAGCAGAGGTACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019694.1-2271s1c1
Sequence:CCGGGCTGAAATTGTGGCCACACTACTCGAGTAGTGTGGCCACAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019694.1-824s1c1
Sequence:CCGGGCCTGTAGTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAACTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019694.1-2271s21c1
Sequence:CCGGGCTGAAATTGTGGCCACACTACTCGAGTAGTGTGGCCACAATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-2177s21c1
Sequence:CCGGTGATAATAAGGACGGCAATATCTCGAGATATTGCCGTCCTTATTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-2529s21c1
Sequence:CCGGTTCATCATTCCACGAAGATTCCTCGAGGAATCTTCGTGGAATGATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019694
VALIDATED
LETM1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper-EF-hand containing transmembrane protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-327s21c1
Sequence:CCGGCCTGTGTACCTCTGCTTCAAACTCGAGTTTGAAGCAGAGGTACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-824s21c1
Sequence:CCGGGCCTGTAGTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAACTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019694.1-3035s1c1
Sequence:CCGGCGCTCTCTTGAGTTCACCATTCTCGAGAATGGTGAACTCAAGAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019694.1-1466s1c1
Sequence:CCGGCCTTCCAGAAATTGTGGCAAACTCGAGTTTGCCACAATTTCTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019694.1-327s1c1
Sequence:CCGGCCTGTGTACCTCTGCTTCAAACTCGAGTTTGAAGCAGAGGTACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019694.1-2271s1c1
Sequence:CCGGGCTGAAATTGTGGCCACACTACTCGAGTAGTGTGGCCACAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019694.1-824s1c1
Sequence:CCGGGCCTGTAGTTGTGAAGCTCTTCTCGAGAAGAGCTTCACAACTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019694.1-2271s21c1
Sequence:CCGGGCTGAAATTGTGGCCACACTACTCGAGTAGTGTGGCCACAATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-2177s21c1
Sequence:CCGGTGATAATAAGGACGGCAATATCTCGAGATATTGCCGTCCTTATTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019694.1-2529s21c1
Sequence:CCGGTTCATCATTCCACGAAGATTCCTCGAGGAATCTTCGTGGAATGATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012318
VALIDATED
LETM1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper-EF-hand containing transmembrane protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-1200s1c1
Sequence:CCGGCAATGAGGAAATCATGCGTTTCTCGAGAAACGCATGATTTCCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-1200s21c1
Sequence:CCGGCAATGAGGAAATCATGCGTTTCTCGAGAAACGCATGATTTCCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-807s21c1
Sequence:CCGGGCTATGGATCGACACCAAGATCTCGAGATCTTGGTGTCGATCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-1618s1c1
Sequence:CCGGCCAGAGATTGTGGCAAAGGAACTCGAGTTCCTTTGCCACAATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-2133s1c1
Sequence:CCGGGCAGCAAATGATCGGGCAGATCTCGAGATCTGCCCGATCATTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-2133s21c1
Sequence:CCGGGCAGCAAATGATCGGGCAGATCTCGAGATCTGCCCGATCATTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-1618s21c1
Sequence:CCGGCCAGAGATTGTGGCAAAGGAACTCGAGTTCCTTTGCCACAATCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012318.1-2259s1c1
Sequence:CCGGCAACGCCATGAAGCAAGTCAACTCGAGTTGACTTGCTTCATGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-807s1c1
Sequence:CCGGGCTATGGATCGACACCAAGATCTCGAGATCTTGGTGTCGATCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012318
VALIDATED
LETM1 MISSION shRNA shRNA Plasmid DNA
leucine zipper-EF-hand containing transmembrane protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-1200s1c1
Sequence:CCGGCAATGAGGAAATCATGCGTTTCTCGAGAAACGCATGATTTCCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-1200s21c1
Sequence:CCGGCAATGAGGAAATCATGCGTTTCTCGAGAAACGCATGATTTCCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-807s21c1
Sequence:CCGGGCTATGGATCGACACCAAGATCTCGAGATCTTGGTGTCGATCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-1618s1c1
Sequence:CCGGCCAGAGATTGTGGCAAAGGAACTCGAGTTCCTTTGCCACAATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-2133s1c1
Sequence:CCGGGCAGCAAATGATCGGGCAGATCTCGAGATCTGCCCGATCATTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-2133s21c1
Sequence:CCGGGCAGCAAATGATCGGGCAGATCTCGAGATCTGCCCGATCATTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-1618s21c1
Sequence:CCGGCCAGAGATTGTGGCAAAGGAACTCGAGTTCCTTTGCCACAATCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012318.1-2259s1c1
Sequence:CCGGCAACGCCATGAAGCAAGTCAACTCGAGTTGACTTGCTTCATGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-807s1c1
Sequence:CCGGGCTATGGATCGACACCAAGATCTCGAGATCTTGGTGTCGATCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012318
VALIDATED
LETM1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper-EF-hand containing transmembrane protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-1200s1c1
Sequence:CCGGCAATGAGGAAATCATGCGTTTCTCGAGAAACGCATGATTTCCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-1200s21c1
Sequence:CCGGCAATGAGGAAATCATGCGTTTCTCGAGAAACGCATGATTTCCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-807s21c1
Sequence:CCGGGCTATGGATCGACACCAAGATCTCGAGATCTTGGTGTCGATCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-1618s1c1
Sequence:CCGGCCAGAGATTGTGGCAAAGGAACTCGAGTTCCTTTGCCACAATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-2133s1c1
Sequence:CCGGGCAGCAAATGATCGGGCAGATCTCGAGATCTGCCCGATCATTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-2133s21c1
Sequence:CCGGGCAGCAAATGATCGGGCAGATCTCGAGATCTGCCCGATCATTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012318.2-1618s21c1
Sequence:CCGGCCAGAGATTGTGGCAAAGGAACTCGAGTTCCTTTGCCACAATCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012318.1-2259s1c1
Sequence:CCGGCAACGCCATGAAGCAAGTCAACTCGAGTTGACTTGCTTCATGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012318.1-807s1c1
Sequence:CCGGGCTATGGATCGACACCAAGATCTCGAGATCTTGGTGTCGATCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)