EMAIL THIS PAGE TO A FRIEND

LETM2

leucine zipper-EF-hand containing transmembrane protein 2

117 Gene Product Result for
UniProtKB ID: Q2VYF4, A6NMG3, Q8NCR2, Q96LL1
Gene ID:
Mouse(270035) leucine zipper-EF-hand containing transmembrane protein 2
Rat(361169) leucine zipper-EF-hand containing transmembrane protein 2
Zebrafish(100006201) leucine zipper-EF-hand containing transmembrane protein 2
domestic cat(101086303) leucine zipper-EF-hand containing transmembrane protein 2
cow(783086) leucine zipper-EF-hand containing transmembrane protein 2
Horse(100057651) leucine zipper-EF-hand containing transmembrane protein 2
dog(475583) leucine zipper-EF-hand containing transmembrane protein 2
chicken(426779) leucine zipper-EF-hand containing transmembrane protein 2
sheep(101119017) leucine zipper-EF-hand containing transmembrane protein 2
Domestic Rabbit(100352451) leucine zipper-EF-hand containing transmembrane protein 2
domestic guinea pig(100728580) leucine zipper-EF-hand containing transmembrane protein 2
naked mole-rat(101699965) leucine zipper-EF-hand containing transmembrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144652 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144652 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144652 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144652 Rosetta Predictions human pricing
NM_001012158 Rosetta Predictions rat pricing
XM_573935 Rosetta Predictions rat pricing
NM_173012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364528 predicted 237
2 SASI_Hs01_00033301 predicted 1133
3 SASI_Hs01_00033303 predicted 224
4 SASI_Hs01_00033304 predicted 829
5 SASI_Hs02_00364529 predicted 1269
6 SASI_Hs01_00033305 predicted 885
7 SASI_Hs01_00033306 predicted 200
8 SASI_Hs01_00033307 predicted 623
9 SASI_Hs01_00033308 predicted 1401
10 SASI_Hs02_00364530 predicted 645
11 SASI_Hs01_00033299 predicted 1189
12 SASI_Hs01_00033300 predicted 331
13 SASI_Hs01_00033302 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102313 predicted 1434
2 SASI_Rn02_00200346 predicted 1462
3 SASI_Rn01_00102315 predicted 560
4 SASI_Rn01_00102316 predicted 1280
5 SASI_Rn01_00102317 predicted 468
6 SASI_Rn01_00102318 predicted 347
7 SASI_Rn01_00102319 predicted 1013
8 SASI_Rn01_00102322 predicted 482
9 SASI_Rn02_00200347 predicted 903
10 SASI_Rn02_00200348 predicted 1103
11 SASI_Rn01_00102314 predicted 694
12 SASI_Rn01_00102320 predicted 628
13 SASI_Rn01_00102321 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125831 predicted 276
2 SASI_Rn01_00125832 predicted 2550
3 SASI_Rn01_00125833 predicted 1800
4 SASI_Rn01_00125834 predicted 2404
5 SASI_Rn01_00125835 predicted 471
6 SASI_Rn01_00125836 predicted 350
7 SASI_Rn01_00125837 predicted 2131
8 SASI_Rn01_00125838 predicted 1736
9 SASI_Rn01_00125839 predicted 1874
10 SASI_Rn01_00125840 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345067 predicted 1299
2 SASI_Mm02_00345068 predicted 1522
3 SASI_Mm02_00345069 predicted 1819
4 SASI_Mm02_00345070 predicted 1705
5 SASI_Mm01_00111661 predicted 773
6 SASI_Mm01_00111664 predicted 723
7 SASI_Mm01_00111665 predicted 637
8 SASI_Mm01_00111667 predicted 797
9 SASI_Mm02_00345071 predicted 1317
10 SASI_Mm01_00111669 predicted 779
11 SASI_Mm01_00111660 predicted 1028
12 SASI_Mm01_00111662 predicted 790
13 SASI_Mm01_00111663 predicted 870
14 SASI_Mm01_00111666 predicted 880
15 SASI_Mm01_00111668 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144652
LETM2 MISSION shRNA Bacterial Glycerol Stock
leucine zipper-EF-hand containing transmembrane protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144652.1-837s21c1
Sequence:CCGGGATGAAACTGAAGTCTATAAACTCGAGTTTATAGACTTCAGTTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144652.1-1560s21c1
Sequence:CCGGATAATTGCAAAGTCCCATTTCCTCGAGGAAATGGGACTTTGCAATTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144652.1-358s21c1
Sequence:CCGGGAAACTGGCATGGAGATTAAACTCGAGTTTAATCTCCATGCCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-1045s1c1
Sequence:CCGGCGCACCTTCTACCTGATAGATCTCGAGATCTATCAGGTAGAAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-1222s1c1
Sequence:CCGGCCAGTTACATCATCACCCATACTCGAGTATGGGTGATGATGTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-895s1c1
Sequence:CCGGGCATTGAGTGTATCAGAACTACTCGAGTAGTTCTGATACACTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-235s1c1
Sequence:CCGGCCAGGAACTAGACTAATACAACTCGAGTTGTATTAGTCTAGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-688s1c1
Sequence:CCGGCCCAGCACAAAGGAGATAGTTCTCGAGAACTATCTCCTTTGTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144652
LETM2 MISSION shRNA shRNA Plasmid DNA
leucine zipper-EF-hand containing transmembrane protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144652.1-837s21c1
Sequence:CCGGGATGAAACTGAAGTCTATAAACTCGAGTTTATAGACTTCAGTTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144652.1-1560s21c1
Sequence:CCGGATAATTGCAAAGTCCCATTTCCTCGAGGAAATGGGACTTTGCAATTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144652.1-358s21c1
Sequence:CCGGGAAACTGGCATGGAGATTAAACTCGAGTTTAATCTCCATGCCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-1045s1c1
Sequence:CCGGCGCACCTTCTACCTGATAGATCTCGAGATCTATCAGGTAGAAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-1222s1c1
Sequence:CCGGCCAGTTACATCATCACCCATACTCGAGTATGGGTGATGATGTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-895s1c1
Sequence:CCGGGCATTGAGTGTATCAGAACTACTCGAGTAGTTCTGATACACTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-235s1c1
Sequence:CCGGCCAGGAACTAGACTAATACAACTCGAGTTGTATTAGTCTAGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-688s1c1
Sequence:CCGGCCCAGCACAAAGGAGATAGTTCTCGAGAACTATCTCCTTTGTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144652
LETM2 MISSION shRNA Lentiviral Transduction Particles
leucine zipper-EF-hand containing transmembrane protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144652.1-837s21c1
Sequence:CCGGGATGAAACTGAAGTCTATAAACTCGAGTTTATAGACTTCAGTTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144652.1-1560s21c1
Sequence:CCGGATAATTGCAAAGTCCCATTTCCTCGAGGAAATGGGACTTTGCAATTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144652.1-358s21c1
Sequence:CCGGGAAACTGGCATGGAGATTAAACTCGAGTTTAATCTCCATGCCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-1045s1c1
Sequence:CCGGCGCACCTTCTACCTGATAGATCTCGAGATCTATCAGGTAGAAGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-1222s1c1
Sequence:CCGGCCAGTTACATCATCACCCATACTCGAGTATGGGTGATGATGTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-895s1c1
Sequence:CCGGGCATTGAGTGTATCAGAACTACTCGAGTAGTTCTGATACACTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-235s1c1
Sequence:CCGGCCAGGAACTAGACTAATACAACTCGAGTTGTATTAGTCTAGTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144652.1-688s1c1
Sequence:CCGGCCCAGCACAAAGGAGATAGTTCTCGAGAACTATCTCCTTTGTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173012
LETM2 MISSION shRNA Bacterial Glycerol Stock
leucine zipper-EF-hand containing transmembrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173012.1-2305s1c1
Sequence:CCGGCCTGTGGGTTTGCTGTTGATACTCGAGTATCAACAGCAAACCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-513s1c1
Sequence:CCGGGCATTTCTCCACTTGCCAGATCTCGAGATCTGGCAAGTGGAGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-538s1c1
Sequence:CCGGACTTGCGTACAGCCTACATTACTCGAGTAATGTAGGCTGTACGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-852s1c1
Sequence:CCGGGCCAGAATAGTGTGGAGGCTACTCGAGTAGCCTCCACACTATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-589s1c1
Sequence:CCGGCCAGTCTAACAGGCAATAATACTCGAGTATTATTGCCTGTTAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173012
LETM2 MISSION shRNA shRNA Plasmid DNA
leucine zipper-EF-hand containing transmembrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173012.1-2305s1c1
Sequence:CCGGCCTGTGGGTTTGCTGTTGATACTCGAGTATCAACAGCAAACCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-513s1c1
Sequence:CCGGGCATTTCTCCACTTGCCAGATCTCGAGATCTGGCAAGTGGAGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-538s1c1
Sequence:CCGGACTTGCGTACAGCCTACATTACTCGAGTAATGTAGGCTGTACGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-852s1c1
Sequence:CCGGGCCAGAATAGTGTGGAGGCTACTCGAGTAGCCTCCACACTATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-589s1c1
Sequence:CCGGCCAGTCTAACAGGCAATAATACTCGAGTATTATTGCCTGTTAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173012
LETM2 MISSION shRNA Lentiviral Transduction Particles
leucine zipper-EF-hand containing transmembrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104650    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173012.1-2305s1c1
Sequence:CCGGCCTGTGGGTTTGCTGTTGATACTCGAGTATCAACAGCAAACCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-513s1c1
Sequence:CCGGGCATTTCTCCACTTGCCAGATCTCGAGATCTGGCAAGTGGAGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-538s1c1
Sequence:CCGGACTTGCGTACAGCCTACATTACTCGAGTAATGTAGGCTGTACGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-852s1c1
Sequence:CCGGGCCAGAATAGTGTGGAGGCTACTCGAGTAGCCTCCACACTATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173012.1-589s1c1
Sequence:CCGGCCAGTCTAACAGGCAATAATACTCGAGTATTATTGCCTGTTAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)