EMAIL THIS PAGE TO A FRIEND

LFNG

LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase

105 Gene Product Result for
Synonyms: SCDO3
UniProtKB ID: Q8NES3, B3KTY6, B5MCR5, O00589, Q96C39, Q9UJW5
Gene ID:
Human(3955) Summary: This gene is a member of the fringe gene family which also includes radical and manic fringe genes. They all encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. This gene product is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(16848) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Rat(170905) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Zebrafish(30158) lunatic fringe homolog
dog(489891) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
chicken(395790) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
cow(516209) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
domestic guinea pig(100730084) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
naked mole-rat(101699763) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
sheep(101112372) LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44923 Anti-LFNG antibody produced in rabbit affinity isolated antibody rat, guinea pig, human, yeast, mouse, horse
western blot pricing
HPA069130 Anti-LFNG antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410753 Anti-LFNG antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
WH0003955M6 Monoclonal Anti-LFNG antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1404021 Monoclonal Anti-LFNG antibody produced in mouse clone 2D10-3C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409281 Monoclonal Anti-LFNG antibody produced in mouse clone 1F9, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB1409282 Monoclonal Anti-LFNG antibody produced in mouse clone 4F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing
SAB1409283 Monoclonal Anti-LFNG antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409284 Monoclonal Anti-LFNG antibody produced in mouse clone 3B5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409285 Monoclonal Anti-LFNG antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409286 Monoclonal Anti-LFNG antibody produced in mouse clone 3C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409287 Monoclonal Anti-LFNG antibody produced in mouse clone 1B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409288 Monoclonal Anti-LFNG antibody produced in mouse clone 3C4, ascites fluid, solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002304 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU005371 MISSION® esiRNA esiRNA targeting mouse Lfng (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040167 Rosetta Predictions human pricing
NM_001040168 Rosetta Predictions human pricing
NM_133393 Rosetta Predictions rat pricing
NM_008494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169653 predicted 793
2 SASI_Hs01_00169654 predicted 793
3 SASI_Hs01_00169655 predicted 666
4 SASI_Hs01_00169656 predicted 570
5 SASI_Hs01_00169657 predicted 720
6 SASI_Hs01_00169658 predicted 559
7 SASI_Hs01_00169659 predicted 747
8 SASI_Hs01_00169660 predicted 857
9 SASI_Hs01_00169661 predicted 728
10 SASI_Hs01_00169662 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060184 predicted 793
2 SASI_Hs01_00060185 predicted 795
3 SASI_Hs01_00060186 predicted 662
4 SASI_Hs01_00060187 predicted 567
5 SASI_Hs01_00060188 predicted 720
6 SASI_Hs01_00060189 predicted 553
7 SASI_Hs01_00060190 predicted 750
8 SASI_Hs01_00060191 predicted 859
9 SASI_Hs01_00060192 predicted 725
10 SASI_Hs01_00060193 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109084 predicted 534
2 SASI_Rn01_00109085 predicted 1083
3 SASI_Rn01_00109086 predicted 531
4 SASI_Rn01_00109087 predicted 603
5 SASI_Rn01_00109088 predicted 384
6 SASI_Rn01_00109089 predicted 1114
7 SASI_Rn01_00109090 predicted 419
8 SASI_Rn01_00109091 predicted 1542
9 SASI_Rn01_00109092 predicted 1588
10 SASI_Rn01_00109093 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165051 predicted 774
2 SASI_Mm02_00314042 predicted 494
3 SASI_Mm01_00165052 predicted 544
4 SASI_Mm01_00165053 predicted 623
5 SASI_Mm01_00165054 predicted 291
6 SASI_Mm01_00165055 predicted 283
7 SASI_Mm01_00165056 predicted 422
8 SASI_Mm01_00165057 predicted 612
9 SASI_Mm01_00165058 predicted 607
10 SASI_Mm01_00165059 predicted 943
11 SASI_Mm01_00165060 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002304
LFNG MISSION shRNA Bacterial Glycerol Stock
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-695s1c1
Sequence:CCGGCTGAGCTACGGTATGTTTGAACTCGAGTTCAAACATACCGTAGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1818s1c1
Sequence:CCGGGCACTCTGTGTATTTATGCGTCTCGAGACGCATAAATACACAGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-301s1c1
Sequence:CCGGCGATGACAACTACGTCAACCTCTCGAGAGGTTGACGTAGTTGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-128s1c1
Sequence:CCGGGTAGAGACGTTCATCTTCACTCTCGAGAGTGAAGATGAACGTCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1564s1c1
Sequence:CCGGGCATTTAATCTCCTCTCCAAACTCGAGTTTGGAGAGGAGATTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-121s1c1
Sequence:CCGGCATTCAGGTAGAGACGTTCATCTCGAGATGAACGTCTCTACCTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1135s1c1
Sequence:CCGGCGAGGGCAATTCTGTTAGGATCTCGAGATCCTAACAGAATTGCCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1559s1c1
Sequence:CCGGGCTCAGCATTTAATCTCCTCTCTCGAGAGAGGAGATTAAATGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002304
LFNG MISSION shRNA shRNA Plasmid DNA
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-695s1c1
Sequence:CCGGCTGAGCTACGGTATGTTTGAACTCGAGTTCAAACATACCGTAGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1818s1c1
Sequence:CCGGGCACTCTGTGTATTTATGCGTCTCGAGACGCATAAATACACAGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-301s1c1
Sequence:CCGGCGATGACAACTACGTCAACCTCTCGAGAGGTTGACGTAGTTGTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-128s1c1
Sequence:CCGGGTAGAGACGTTCATCTTCACTCTCGAGAGTGAAGATGAACGTCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1564s1c1
Sequence:CCGGGCATTTAATCTCCTCTCCAAACTCGAGTTTGGAGAGGAGATTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-121s1c1
Sequence:CCGGCATTCAGGTAGAGACGTTCATCTCGAGATGAACGTCTCTACCTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1135s1c1
Sequence:CCGGCGAGGGCAATTCTGTTAGGATCTCGAGATCCTAACAGAATTGCCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1559s1c1
Sequence:CCGGGCTCAGCATTTAATCTCCTCTCTCGAGAGAGGAGATTAAATGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002304
LFNG MISSION shRNA Lentiviral Transduction Particles
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-695s1c1
Sequence:CCGGCTGAGCTACGGTATGTTTGAACTCGAGTTCAAACATACCGTAGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1818s1c1
Sequence:CCGGGCACTCTGTGTATTTATGCGTCTCGAGACGCATAAATACACAGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-301s1c1
Sequence:CCGGCGATGACAACTACGTCAACCTCTCGAGAGGTTGACGTAGTTGTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-128s1c1
Sequence:CCGGGTAGAGACGTTCATCTTCACTCTCGAGAGTGAAGATGAACGTCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1564s1c1
Sequence:CCGGGCATTTAATCTCCTCTCCAAACTCGAGTTTGGAGAGGAGATTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002304.1-121s1c1
Sequence:CCGGCATTCAGGTAGAGACGTTCATCTCGAGATGAACGTCTCTACCTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1135s1c1
Sequence:CCGGCGAGGGCAATTCTGTTAGGATCTCGAGATCCTAACAGAATTGCCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002304.1-1559s1c1
Sequence:CCGGGCTCAGCATTTAATCTCCTCTCTCGAGAGAGGAGATTAAATGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008494
LFNG MISSION shRNA Bacterial Glycerol Stock
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-1100s1c1
Sequence:CCGGCTATGGCATGTTTGAGAACAACTCGAGTTGTTCTCAAACATGCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-648s1c1
Sequence:CCGGGTGGAGTATGACCGATTCATTCTCGAGAATGAATCGGTCATACTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-455s1c1
Sequence:CCGGCGTCAAGACCACCAGAAAGTTCTCGAGAACTTTCTGGTGGTCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-647s1c1
Sequence:CCGGTGTGGAGTATGACCGATTCATCTCGAGATGAATCGGTCATACTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-521s1c1
Sequence:CCGGCCACAAGGAGATGACGTTCATCTCGAGATGAACGTCATCTCCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008494
LFNG MISSION shRNA shRNA Plasmid DNA
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-1100s1c1
Sequence:CCGGCTATGGCATGTTTGAGAACAACTCGAGTTGTTCTCAAACATGCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-648s1c1
Sequence:CCGGGTGGAGTATGACCGATTCATTCTCGAGAATGAATCGGTCATACTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-455s1c1
Sequence:CCGGCGTCAAGACCACCAGAAAGTTCTCGAGAACTTTCTGGTGGTCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-647s1c1
Sequence:CCGGTGTGGAGTATGACCGATTCATCTCGAGATGAATCGGTCATACTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-521s1c1
Sequence:CCGGCCACAAGGAGATGACGTTCATCTCGAGATGAACGTCATCTCCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008494
LFNG MISSION shRNA Lentiviral Transduction Particles
LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-1100s1c1
Sequence:CCGGCTATGGCATGTTTGAGAACAACTCGAGTTGTTCTCAAACATGCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-648s1c1
Sequence:CCGGGTGGAGTATGACCGATTCATTCTCGAGAATGAATCGGTCATACTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-455s1c1
Sequence:CCGGCGTCAAGACCACCAGAAAGTTCTCGAGAACTTTCTGGTGGTCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-647s1c1
Sequence:CCGGTGTGGAGTATGACCGATTCATCTCGAGATGAATCGGTCATACTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008494.2-521s1c1
Sequence:CCGGCCACAAGGAGATGACGTTCATCTCGAGATGAACGTCATCTCCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)