EMAIL THIS PAGE TO A FRIEND

LGALS12

lectin, galactoside-binding, soluble, 12

55 Gene Product Result for
Synonyms: GAL12 GRIP1
Gene ID:
Human(85329) Summary: This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
Mouse(56072) lectin, galactose binding, soluble 12
Rat(293710) lectin, galactoside-binding, soluble, 12
dog(483773) lectin, galactoside-binding, soluble, 12
cow(518931) lectin, galactoside-binding, soluble, 12
domestic cat(101089963) lectin, galactoside-binding, soluble, 12
domestic guinea pig(100726929) lectin, galactoside-binding, soluble, 12
naked mole-rat(101706777) lectin, galactoside-binding, soluble, 12
sheep(101114068) lectin, galactoside-binding, soluble, 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033101 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033101 Rosetta Predictions human pricing
NM_001106333 Rosetta Predictions rat pricing
NM_019516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089349 predicted 391
2 SASI_Hs01_00089350 predicted 1282
3 SASI_Hs01_00089351 predicted 481
4 SASI_Hs01_00089352 predicted 842
5 SASI_Hs01_00089353 predicted 401
6 SASI_Hs01_00089354 predicted 686
7 SASI_Hs02_00360805 predicted 887
8 SASI_Hs01_00089355 predicted 811
9 SASI_Hs01_00089357 predicted 448
10 SASI_Hs01_00089358 predicted 525
11 SASI_Hs01_00089356 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217938 predicted 1833
2 SASI_Rn02_00217939 predicted 660
3 SASI_Rn02_00217940 predicted 792
4 SASI_Rn02_00217941 predicted 528
5 SASI_Rn02_00217942 predicted 1134
6 SASI_Rn02_00217943 predicted 967
7 SASI_Rn02_00217944 predicted 849
8 SASI_Rn02_00217945 predicted 819
9 SASI_Rn02_00217946 predicted 610
10 SASI_Rn02_00217947 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049653 predicted 966
2 SASI_Mm01_00049654 predicted 1072
3 SASI_Mm01_00049655 predicted 949
4 SASI_Mm01_00049656 predicted 514
5 SASI_Mm01_00049657 predicted 1112
6 SASI_Mm01_00049658 predicted 1236
7 SASI_Mm01_00049660 predicted 659
8 SASI_Mm01_00049661 predicted 644
9 SASI_Mm02_00324558 predicted 464
10 SASI_Mm02_00324559 predicted 662
11 SASI_Mm01_00049659 predicted 616
12 SASI_Mm01_00049662 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019516
LGALS12 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019516.3-1063s21c1
Sequence:CCGGTTCGAGGACTGGTCTTGAAAGCTCGAGCTTTCAAGACCAGTCCTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019516.3-1270s21c1
Sequence:CCGGGGCTGAAGTTGGCACTCAATGCTCGAGCATTGAGTGCCAACTTCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019516.3-1644s21c1
Sequence:CCGGATCTATCTTCCACATTCAAATCTCGAGATTTGAATGTGGAAGATAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019516.1-1680s1c1
Sequence:CCGGGCCAGGGATTATTCAGTCTATCTCGAGATAGACTGAATAATCCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-208s1c1
Sequence:CCGGCGGTGATTCCTTATGGCACAACTCGAGTTGTGCCATAAGGAATCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-649s1c1
Sequence:CCGGGCAGAGAGTATCCAGTTGGATCTCGAGATCCAACTGGATACTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-365s1c1
Sequence:CCGGCCCTCGATTCTACACTGTCAACTCGAGTTGACAGTGTAGAATCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-567s1c1
Sequence:CCGGCGGGTAGATACCCTTGACATACTCGAGTATGTCAAGGGTATCTACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019516
LGALS12 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019516.3-1063s21c1
Sequence:CCGGTTCGAGGACTGGTCTTGAAAGCTCGAGCTTTCAAGACCAGTCCTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019516.3-1270s21c1
Sequence:CCGGGGCTGAAGTTGGCACTCAATGCTCGAGCATTGAGTGCCAACTTCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019516.3-1644s21c1
Sequence:CCGGATCTATCTTCCACATTCAAATCTCGAGATTTGAATGTGGAAGATAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019516.1-1680s1c1
Sequence:CCGGGCCAGGGATTATTCAGTCTATCTCGAGATAGACTGAATAATCCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-208s1c1
Sequence:CCGGCGGTGATTCCTTATGGCACAACTCGAGTTGTGCCATAAGGAATCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-649s1c1
Sequence:CCGGGCAGAGAGTATCCAGTTGGATCTCGAGATCCAACTGGATACTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-365s1c1
Sequence:CCGGCCCTCGATTCTACACTGTCAACTCGAGTTGACAGTGTAGAATCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-567s1c1
Sequence:CCGGCGGGTAGATACCCTTGACATACTCGAGTATGTCAAGGGTATCTACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019516
LGALS12 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019516.3-1063s21c1
Sequence:CCGGTTCGAGGACTGGTCTTGAAAGCTCGAGCTTTCAAGACCAGTCCTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019516.3-1270s21c1
Sequence:CCGGGGCTGAAGTTGGCACTCAATGCTCGAGCATTGAGTGCCAACTTCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019516.3-1644s21c1
Sequence:CCGGATCTATCTTCCACATTCAAATCTCGAGATTTGAATGTGGAAGATAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019516.1-1680s1c1
Sequence:CCGGGCCAGGGATTATTCAGTCTATCTCGAGATAGACTGAATAATCCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-208s1c1
Sequence:CCGGCGGTGATTCCTTATGGCACAACTCGAGTTGTGCCATAAGGAATCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-649s1c1
Sequence:CCGGGCAGAGAGTATCCAGTTGGATCTCGAGATCCAACTGGATACTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-365s1c1
Sequence:CCGGCCCTCGATTCTACACTGTCAACTCGAGTTGACAGTGTAGAATCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019516.1-567s1c1
Sequence:CCGGCGGGTAGATACCCTTGACATACTCGAGTATGTCAAGGGTATCTACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033101
LGALS12 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033101.3-1476s21c1
Sequence:CCGGGTCACGAGACTGAGTCTACAGCTCGAGCTGTAGACTCAGTCTCGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033101.3-748s21c1
Sequence:CCGGTCCTCTTTCTCTTCGGGAATGCTCGAGCATTCCCGAAGAGAAAGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-814s1c1
Sequence:CCGGGCTGGGTATATTTGGTGACATCTCGAGATGTCACCAAATATACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-372s1c1
Sequence:CCGGCTGTCATGTCACCTGGAGAAACTCGAGTTTCTCCAGGTGACATGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-974s1c1
Sequence:CCGGCCTGGGCAGGTCATCATAGTACTCGAGTACTATGATGACCTGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-449s1c1
Sequence:CCGGGTTCCTTATGTCACGACGATTCTCGAGAATCGTCGTGACATAAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-401s1c1
Sequence:CCGGCCAATTCCTGACAGCTTCATTCTCGAGAATGAAGCTGTCAGGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033101
LGALS12 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033101.3-1476s21c1
Sequence:CCGGGTCACGAGACTGAGTCTACAGCTCGAGCTGTAGACTCAGTCTCGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033101.3-748s21c1
Sequence:CCGGTCCTCTTTCTCTTCGGGAATGCTCGAGCATTCCCGAAGAGAAAGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-814s1c1
Sequence:CCGGGCTGGGTATATTTGGTGACATCTCGAGATGTCACCAAATATACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-372s1c1
Sequence:CCGGCTGTCATGTCACCTGGAGAAACTCGAGTTTCTCCAGGTGACATGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-974s1c1
Sequence:CCGGCCTGGGCAGGTCATCATAGTACTCGAGTACTATGATGACCTGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-449s1c1
Sequence:CCGGGTTCCTTATGTCACGACGATTCTCGAGAATCGTCGTGACATAAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-401s1c1
Sequence:CCGGCCAATTCCTGACAGCTTCATTCTCGAGAATGAAGCTGTCAGGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033101
LGALS12 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033101.3-1476s21c1
Sequence:CCGGGTCACGAGACTGAGTCTACAGCTCGAGCTGTAGACTCAGTCTCGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033101.3-748s21c1
Sequence:CCGGTCCTCTTTCTCTTCGGGAATGCTCGAGCATTCCCGAAGAGAAAGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-814s1c1
Sequence:CCGGGCTGGGTATATTTGGTGACATCTCGAGATGTCACCAAATATACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-372s1c1
Sequence:CCGGCTGTCATGTCACCTGGAGAAACTCGAGTTTCTCCAGGTGACATGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-974s1c1
Sequence:CCGGCCTGGGCAGGTCATCATAGTACTCGAGTACTATGATGACCTGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-449s1c1
Sequence:CCGGGTTCCTTATGTCACGACGATTCTCGAGAATCGTCGTGACATAAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033101.2-401s1c1
Sequence:CCGGCCAATTCCTGACAGCTTCATTCTCGAGAATGAAGCTGTCAGGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)