EMAIL THIS PAGE TO A FRIEND

LGALS13

lectin, galactoside-binding, soluble, 13

22 Gene Product Result for
Synonyms: GAL13 PLAC8 PP13
Species: Human LGALS13(29124)
UniProtKB ID: Q9UHV8, C5HZ15
Gene ID:
Human(29124) Summary: Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene has lysophospholipase activity. It is composed of two identical subunits which are held together by disulfide bonds. This protein has structural similarity to several members of the beta-galactoside-binding S-type lectin family. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013268 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033841 MISSION® esiRNA esiRNA human LGALS13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013268 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139214 predicted 354
2 SASI_Hs02_00344502 predicted 304
3 SASI_Hs01_00139215 predicted 329
4 SASI_Hs01_00139216 predicted 312
5 SASI_Hs01_00139217 predicted 360
6 SASI_Hs02_00344503 predicted 307
7 SASI_Hs01_00139219 predicted 357
8 SASI_Hs01_00139220 predicted 344
9 SASI_Hs01_00139221 predicted 214
10 SASI_Hs01_00139222 predicted 202
11 SASI_Hs01_00139218 predicted 284
12 SASI_Hs01_00139223 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013268
LGALS13 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-109s1c2
Sequence:CCGGAGGGACACCAATCCACTCTTTCTCGAGAAAGAGTGGATTGGTGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-211s1c1
Sequence:CCGGCTTTGGCAATCATGTGGTCATCTCGAGATGACCACATGATTGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-310s1c1
Sequence:CCGGGCTGTGCATCTACGTACATTACTCGAGTAATGTACGTAGATGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-388s1c1
Sequence:CCGGCCCGCCATCATTTGTGAAGATCTCGAGATCTTCACAAATGATGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-203s1c1
Sequence:CCGGCGAGTGCACTTTGGCAATCATCTCGAGATGATTGCCAAAGTGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013268
LGALS13 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-109s1c2
Sequence:CCGGAGGGACACCAATCCACTCTTTCTCGAGAAAGAGTGGATTGGTGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-211s1c1
Sequence:CCGGCTTTGGCAATCATGTGGTCATCTCGAGATGACCACATGATTGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-310s1c1
Sequence:CCGGGCTGTGCATCTACGTACATTACTCGAGTAATGTACGTAGATGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-388s1c1
Sequence:CCGGCCCGCCATCATTTGTGAAGATCTCGAGATCTTCACAAATGATGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-203s1c1
Sequence:CCGGCGAGTGCACTTTGGCAATCATCTCGAGATGATTGCCAAAGTGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013268
LGALS13 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-109s1c2
Sequence:CCGGAGGGACACCAATCCACTCTTTCTCGAGAAAGAGTGGATTGGTGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-211s1c1
Sequence:CCGGCTTTGGCAATCATGTGGTCATCTCGAGATGACCACATGATTGCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-310s1c1
Sequence:CCGGGCTGTGCATCTACGTACATTACTCGAGTAATGTACGTAGATGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-388s1c1
Sequence:CCGGCCCGCCATCATTTGTGAAGATCTCGAGATCTTCACAAATGATGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013268.2-203s1c1
Sequence:CCGGCGAGTGCACTTTGGCAATCATCTCGAGATGATTGCCAAAGTGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)