EMAIL THIS PAGE TO A FRIEND

LGALS14

lectin, galactoside-binding, soluble, 14

28 Gene Product Result for
Synonyms: CLC2 PPL13
Species: Human LGALS14(56891)
Gene ID:
Human(56891) Summary: This gene is predominantly expressed in placenta. The encoded protein belongs to the galectin (galaptin/S-lectin) family. The members of galectin family contain one or two carbohydrate recognition domains, which can bind beta-galactoside. Two alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105469 Anti-LGALS14, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020129 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097841 MISSION® esiRNA esiRNA human LGALS14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020129 Rosetta Predictions human pricing
NM_203471 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119096 predicted 442
2 SASI_Hs01_00119097 predicted 493
3 SASI_Hs01_00119098 predicted 528
4 SASI_Hs01_00119099 predicted 529
5 SASI_Hs01_00119100 predicted 448
6 SASI_Hs01_00119101 predicted 444
7 SASI_Hs01_00119102 predicted 443
8 SASI_Hs01_00119103 predicted 492
9 SASI_Hs01_00119104 predicted 503
10 SASI_Hs01_00119105 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243552 predicted 744
2 SASI_Hs01_00243553 predicted 797
3 SASI_Hs01_00243554 predicted 829
4 SASI_Hs01_00243555 predicted 836
5 SASI_Hs01_00243556 predicted 757
6 SASI_Hs01_00243557 predicted 754
7 SASI_Hs01_00243558 predicted 744
8 SASI_Hs01_00243559 predicted 798
9 SASI_Hs01_00243560 predicted 803
10 SASI_Hs01_00243561 predicted 755
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020129
LGALS14 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 14
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-433s1c1
Sequence:CCGGCATATGGAGATATGAGGAGAACTCGAGTTCTCCTCATATCTCCATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-255s1c1
Sequence:CCGGCTGTTTCCTTGCCTGTTGGTTCTCGAGAACCAACAGGCAAGGAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-621s1c1
Sequence:CCGGCCAGAGTGCTTATCAGCGATTCTCGAGAATCGCTGATAAGCACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-467s1c1
Sequence:CCGGCCCTTTGAAGATGGCAAACCACTCGAGTGGTTTGCCATCTTCAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-578s1c1
Sequence:CCGGGCATCTGTGAAGATGCTGCAACTCGAGTTGCAGCATCTTCACAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-283s1c1
Sequence:CCGGGATAATCACAGGGACACCGATCTCGAGATCGGTGTCCCTGTGATTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-391s1c1
Sequence:CCGGGCACTTTGGTCATCCTGCAATCTCGAGATTGCAGGATGACCAAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-545s1c1
Sequence:CCGGCGCATTTACAACTTTGCCCATCTCGAGATGGGCAAAGTTGTAAATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-404s1c1
Sequence:CCGGCCTGCAATCATGAACAGTTGTCTCGAGACAACTGTTCATGATTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-468s1c1
Sequence:CCGGCCTTTGAAGATGGCAAACCATCTCGAGATGGTTTGCCATCTTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-469s1c1
Sequence:CCGGCTTTGAAGATGGCAAACCATTCTCGAGAATGGTTTGCCATCTTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020129
LGALS14 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 14
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-433s1c1
Sequence:CCGGCATATGGAGATATGAGGAGAACTCGAGTTCTCCTCATATCTCCATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-255s1c1
Sequence:CCGGCTGTTTCCTTGCCTGTTGGTTCTCGAGAACCAACAGGCAAGGAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-621s1c1
Sequence:CCGGCCAGAGTGCTTATCAGCGATTCTCGAGAATCGCTGATAAGCACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-467s1c1
Sequence:CCGGCCCTTTGAAGATGGCAAACCACTCGAGTGGTTTGCCATCTTCAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-578s1c1
Sequence:CCGGGCATCTGTGAAGATGCTGCAACTCGAGTTGCAGCATCTTCACAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-283s1c1
Sequence:CCGGGATAATCACAGGGACACCGATCTCGAGATCGGTGTCCCTGTGATTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-391s1c1
Sequence:CCGGGCACTTTGGTCATCCTGCAATCTCGAGATTGCAGGATGACCAAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-545s1c1
Sequence:CCGGCGCATTTACAACTTTGCCCATCTCGAGATGGGCAAAGTTGTAAATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-404s1c1
Sequence:CCGGCCTGCAATCATGAACAGTTGTCTCGAGACAACTGTTCATGATTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-468s1c1
Sequence:CCGGCCTTTGAAGATGGCAAACCATCTCGAGATGGTTTGCCATCTTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-469s1c1
Sequence:CCGGCTTTGAAGATGGCAAACCATTCTCGAGAATGGTTTGCCATCTTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020129
LGALS14 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 14
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-433s1c1
Sequence:CCGGCATATGGAGATATGAGGAGAACTCGAGTTCTCCTCATATCTCCATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-255s1c1
Sequence:CCGGCTGTTTCCTTGCCTGTTGGTTCTCGAGAACCAACAGGCAAGGAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139415    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-621s1c1
Sequence:CCGGCCAGAGTGCTTATCAGCGATTCTCGAGAATCGCTGATAAGCACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-467s1c1
Sequence:CCGGCCCTTTGAAGATGGCAAACCACTCGAGTGGTTTGCCATCTTCAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-578s1c1
Sequence:CCGGGCATCTGTGAAGATGCTGCAACTCGAGTTGCAGCATCTTCACAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-283s1c1
Sequence:CCGGGATAATCACAGGGACACCGATCTCGAGATCGGTGTCCCTGTGATTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-391s1c1
Sequence:CCGGGCACTTTGGTCATCCTGCAATCTCGAGATTGCAGGATGACCAAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-545s1c1
Sequence:CCGGCGCATTTACAACTTTGCCCATCTCGAGATGGGCAAAGTTGTAAATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-404s1c1
Sequence:CCGGCCTGCAATCATGAACAGTTGTCTCGAGACAACTGTTCATGATTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020129.2-468s1c1
Sequence:CCGGCCTTTGAAGATGGCAAACCATCTCGAGATGGTTTGCCATCTTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020129.2-469s1c1
Sequence:CCGGCTTTGAAGATGGCAAACCATTCTCGAGAATGGTTTGCCATCTTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)