EMAIL THIS PAGE TO A FRIEND

LGALS17A

182 Gene Product Result for
Species: Human LGALS17A(400696)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207646 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207646 Rosetta Predictions human pricing
XR_040250 Rosetta Predictions human pricing
XR_040251 Rosetta Predictions human pricing
XR_040252 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216713 predicted 938
2 SASI_Hs01_00216714 predicted 273
3 SASI_Hs01_00216715 predicted 930
4 SASI_Hs01_00216716 predicted 757
5 SASI_Hs01_00216717 predicted 306
6 SASI_Hs01_00216718 predicted 439
7 SASI_Hs01_00216719 predicted 765
8 SASI_Hs01_00216720 predicted 127
9 SASI_Hs01_00216721 predicted 483
10 SASI_Hs01_00216722 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517196 predicted 303
2 SASI_Hs02_00517197 predicted 347
3 SASI_Hs02_00517198 predicted 343
4 SASI_Hs02_00517199 predicted 276
5 SASI_Hs02_00517200 predicted 334
6 SASI_Hs02_00517201 predicted 223
7 SASI_Hs02_00517202 predicted 207
8 SASI_Hs02_00517203 predicted 203
9 SASI_Hs02_00517204 predicted 334
10 SASI_Hs02_00517205 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517206 predicted 304
2 SASI_Hs02_00517207 predicted 347
3 SASI_Hs02_00517208 predicted 345
4 SASI_Hs02_00517209 predicted 278
5 SASI_Hs02_00517210 predicted 336
6 SASI_Hs02_00517211 predicted 227
7 SASI_Hs02_00517212 predicted 207
8 SASI_Hs02_00517213 predicted 209
9 SASI_Hs02_00517214 predicted 335
10 SASI_Hs02_00517215 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517216 predicted 305
2 SASI_Hs02_00517217 predicted 346
3 SASI_Hs02_00517218 predicted 342
4 SASI_Hs02_00517219 predicted 269
5 SASI_Hs02_00517220 predicted 332
6 SASI_Hs02_00517221 predicted 225
7 SASI_Hs02_00517222 predicted 205
8 SASI_Hs02_00517223 predicted 207
9 SASI_Hs02_00517224 predicted 337
10 SASI_Hs02_00517225 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207646
LGALS17A MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207646.1-1786s1c2
Sequence:CCGGCCCACCAAATTGCTGGCATTACTCGAGTAATGCCAGCAATTTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-480s1c1
Sequence:CCGGGTCATAGTGAATGGGAGTTATCTCGAGATAACTCCCATTCACTATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-349s1c1
Sequence:CCGGGCCGTTCAGAATAATATCCTACTCGAGTAGGATATTATTCTGAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-477s1c1
Sequence:CCGGGCAGTCATAGTGAATGGGAGTCTCGAGACTCCCATTCACTATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-258s1c1
Sequence:CCGGCTTGGCAGTATGAGGTGACATCTCGAGATGTCACCTCATACTGCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207646
LGALS17A MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207646.1-1786s1c2
Sequence:CCGGCCCACCAAATTGCTGGCATTACTCGAGTAATGCCAGCAATTTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-480s1c1
Sequence:CCGGGTCATAGTGAATGGGAGTTATCTCGAGATAACTCCCATTCACTATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-349s1c1
Sequence:CCGGGCCGTTCAGAATAATATCCTACTCGAGTAGGATATTATTCTGAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-477s1c1
Sequence:CCGGGCAGTCATAGTGAATGGGAGTCTCGAGACTCCCATTCACTATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-258s1c1
Sequence:CCGGCTTGGCAGTATGAGGTGACATCTCGAGATGTCACCTCATACTGCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207646
LGALS17A MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222764    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207646.1-1786s1c2
Sequence:CCGGCCCACCAAATTGCTGGCATTACTCGAGTAATGCCAGCAATTTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-480s1c1
Sequence:CCGGGTCATAGTGAATGGGAGTTATCTCGAGATAACTCCCATTCACTATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-349s1c1
Sequence:CCGGGCCGTTCAGAATAATATCCTACTCGAGTAGGATATTATTCTGAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-477s1c1
Sequence:CCGGGCAGTCATAGTGAATGGGAGTCTCGAGACTCCCATTCACTATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207646.1-258s1c1
Sequence:CCGGCTTGGCAGTATGAGGTGACATCTCGAGATGTCACCTCATACTGCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)