EMAIL THIS PAGE TO A FRIEND

LGALS1

lectin, galactoside-binding, soluble, 1

71 Gene Product Result for
Synonyms: GAL1 GBP
UniProtKB ID: P09382, B2R5E8, Q9UDK5
Gene ID:
Human(3956) Summary: The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008]
Mouse(16852) lectin, galactose binding, soluble 1
Rat(56646) lectin, galactoside-binding, soluble, 1
domestic guinea pig(100722354) lectin, galactoside-binding, soluble, 1
naked mole-rat(101719121) lectin, galactoside-binding, soluble, 1
chicken(404269) lectin, galactoside-binding, soluble, 1
dog(610276) lectin, galactoside-binding, soluble, 1
cow(326598) lectin, galactoside-binding, soluble, 1
domestic cat(101098151) lectin, galactoside-binding, soluble, 1
chicken(396491) lectin, galactoside-binding, soluble, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500110 Anti-Galectin-1 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP247, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB1305705 ANTI-GLT antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501428 Anti-Lgals1 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, human, mouse, rat
ELISA, western blot pricing
SAB2501429 Anti-Lgals1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, bovine, bovine, rat, human
ELISA, western blot pricing
SAB1409289 Anti-LGALS1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA000646 Anti-LGALS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunohistochemistry, western blot pricing
SAB2101337 Anti-LGALS1 antibody produced in rabbit affinity isolated antibody rabbit, canine, sheep, rat, goat, human, bovine, horse, mouse, guinea pig, pig
western blot pricing
SAB1410754 Anti-LGALS1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
immunofluorescence, western blot pricing
SAB1305495 MONOCLONAL ANTI-GLT antibody produced in mouse clone 24CT661.4.3, crude ascites, buffered aqueous solution human
western blot pricing
WH0003956M1 Monoclonal Anti-LGALS1 antibody produced in mouse clone 1E8-1B2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1404022 Monoclonal Anti-LGALS1, (N-terminal) antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002305 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034721 MISSION® esiRNA esiRNA human LGALS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002305 Rosetta Predictions human pricing
NM_019904 Rosetta Predictions rat pricing
NM_008495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132990 predicted 260
2 SASI_Hs01_00132991 predicted 264
3 SASI_Hs01_00132992 predicted 207
4 SASI_Hs01_00132993 predicted 213
5 SASI_Hs02_00333613 predicted 261
6 SASI_Hs01_00132994 predicted 213
7 SASI_Hs01_00132995 predicted 306
8 SASI_Hs01_00132996 predicted 255
9 SASI_Hs01_00132997 predicted 267
10 SASI_Hs01_00132998 predicted 213
11 SASI_Hs01_00132999 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085597 predicted 198
2 SASI_Rn01_00085598 predicted 202
3 SASI_Rn01_00085599 predicted 205
4 SASI_Rn01_00085600 predicted 201
5 SASI_Rn01_00085601 predicted 204
6 SASI_Rn01_00085602 predicted 204
7 SASI_Rn01_00085603 predicted 206
8 SASI_Rn01_00085604 predicted 277
9 SASI_Rn01_00085605 predicted 251
10 SASI_Rn01_00085606 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102164 predicted 436
2 SASI_Mm01_00102165 predicted 529
3 SASI_Mm01_00102166 predicted 534
4 SASI_Mm01_00102167 predicted 436
5 SASI_Mm01_00102169 predicted 452
6 SASI_Mm02_00314043 predicted 244
7 SASI_Mm01_00102172 predicted 202
8 SASI_Mm01_00102173 predicted 320
9 SASI_Mm02_00314044 predicted 337
10 SASI_Mm02_00314045 predicted 358
11 SASI_Mm01_00102168 predicted 540
12 SASI_Mm01_00102170 predicted 236
13 SASI_Mm01_00102171 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008495
VALIDATED
LGALS1 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-249s1c1
Sequence:CCGGGTGTGTAACACCAAGGAAGATCTCGAGATCTTCCTTGGTGTTACACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-359s1c1
Sequence:CCGGCCTGACCATCAAGCTGCCAGACTCGAGTCTGGCAGCTTGATGGTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-377s1c1
Sequence:CCGGAGACGGACATGAATTCAAGTTCTCGAGAACTTGAATTCATGTCCGTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-152s1c1
Sequence:CCGGCGCCAAGAGCTTTGTGCTGAACTCGAGTTCAGCACAAAGCTCTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-152s21c1
Sequence:CCGGCGCCAAGAGCTTTGTGCTGAACTCGAGTTCAGCACAAAGCTCTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-359s21c1
Sequence:CCGGCCTGACCATCAAGCTGCCAGACTCGAGTCTGGCAGCTTGATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-249s21c1
Sequence:CCGGGTGTGTAACACCAAGGAAGATCTCGAGATCTTCCTTGGTGTTACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-200s21c1
Sequence:CCGGCCTACACTTCAATCCTCGCTTCTCGAGAAGCGAGGATTGAAGTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-377s21c1
Sequence:CCGGAGACGGACATGAATTCAAGTTCTCGAGAACTTGAATTCATGTCCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008495
VALIDATED
LGALS1 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-249s1c1
Sequence:CCGGGTGTGTAACACCAAGGAAGATCTCGAGATCTTCCTTGGTGTTACACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-359s1c1
Sequence:CCGGCCTGACCATCAAGCTGCCAGACTCGAGTCTGGCAGCTTGATGGTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-377s1c1
Sequence:CCGGAGACGGACATGAATTCAAGTTCTCGAGAACTTGAATTCATGTCCGTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-152s1c1
Sequence:CCGGCGCCAAGAGCTTTGTGCTGAACTCGAGTTCAGCACAAAGCTCTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-152s21c1
Sequence:CCGGCGCCAAGAGCTTTGTGCTGAACTCGAGTTCAGCACAAAGCTCTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-359s21c1
Sequence:CCGGCCTGACCATCAAGCTGCCAGACTCGAGTCTGGCAGCTTGATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-249s21c1
Sequence:CCGGGTGTGTAACACCAAGGAAGATCTCGAGATCTTCCTTGGTGTTACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-200s21c1
Sequence:CCGGCCTACACTTCAATCCTCGCTTCTCGAGAAGCGAGGATTGAAGTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-377s21c1
Sequence:CCGGAGACGGACATGAATTCAAGTTCTCGAGAACTTGAATTCATGTCCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008495
VALIDATED
LGALS1 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-249s1c1
Sequence:CCGGGTGTGTAACACCAAGGAAGATCTCGAGATCTTCCTTGGTGTTACACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-359s1c1
Sequence:CCGGCCTGACCATCAAGCTGCCAGACTCGAGTCTGGCAGCTTGATGGTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-377s1c1
Sequence:CCGGAGACGGACATGAATTCAAGTTCTCGAGAACTTGAATTCATGTCCGTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008495.1-152s1c1
Sequence:CCGGCGCCAAGAGCTTTGTGCTGAACTCGAGTTCAGCACAAAGCTCTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-152s21c1
Sequence:CCGGCGCCAAGAGCTTTGTGCTGAACTCGAGTTCAGCACAAAGCTCTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-359s21c1
Sequence:CCGGCCTGACCATCAAGCTGCCAGACTCGAGTCTGGCAGCTTGATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-249s21c1
Sequence:CCGGGTGTGTAACACCAAGGAAGATCTCGAGATCTTCCTTGGTGTTACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-200s21c1
Sequence:CCGGCCTACACTTCAATCCTCGCTTCTCGAGAAGCGAGGATTGAAGTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008495.2-377s21c1
Sequence:CCGGAGACGGACATGAATTCAAGTTCTCGAGAACTTGAATTCATGTCCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002305
LGALS1 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-368s1c1
Sequence:CCGGGCTGCCAGATGGATACGAATTCTCGAGAATTCGTATCCATCTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-308s1c1
Sequence:CCGGCCAGCCTGGAAGTGTTGCAGACTCGAGTCTGCAACACTTCCAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-239s1c1
Sequence:CCGGCACCATCGTGTGCAACAGCAACTCGAGTTGCTGTTGCACACGATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-95s1c1
Sequence:CCGGCCTGAATCTCAAACCTGGAGACTCGAGTCTCCAGGTTTGAGATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-149s1c1
Sequence:CCGGCGCTAAGAGCTTCGTGCTGAACTCGAGTTCAGCACGAAGCTCTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-217s21c1
Sequence:CCGGCAACCTGTGCCTGCACTTCAACTCGAGTTGAAGTGCAGGCACAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-348s21c1
Sequence:CCGGGTGTTGCAGAGGTGTGCATCACTCGAGTGATGCACACCTCTGCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-468s21c1
Sequence:CCGGACGGTGACTTCAAGATCAAATCTCGAGATTTGATCTTGAAGTCACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002305
LGALS1 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-368s1c1
Sequence:CCGGGCTGCCAGATGGATACGAATTCTCGAGAATTCGTATCCATCTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-308s1c1
Sequence:CCGGCCAGCCTGGAAGTGTTGCAGACTCGAGTCTGCAACACTTCCAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-239s1c1
Sequence:CCGGCACCATCGTGTGCAACAGCAACTCGAGTTGCTGTTGCACACGATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-95s1c1
Sequence:CCGGCCTGAATCTCAAACCTGGAGACTCGAGTCTCCAGGTTTGAGATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-149s1c1
Sequence:CCGGCGCTAAGAGCTTCGTGCTGAACTCGAGTTCAGCACGAAGCTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-217s21c1
Sequence:CCGGCAACCTGTGCCTGCACTTCAACTCGAGTTGAAGTGCAGGCACAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-348s21c1
Sequence:CCGGGTGTTGCAGAGGTGTGCATCACTCGAGTGATGCACACCTCTGCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-468s21c1
Sequence:CCGGACGGTGACTTCAAGATCAAATCTCGAGATTTGATCTTGAAGTCACCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002305
LGALS1 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-368s1c1
Sequence:CCGGGCTGCCAGATGGATACGAATTCTCGAGAATTCGTATCCATCTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-308s1c1
Sequence:CCGGCCAGCCTGGAAGTGTTGCAGACTCGAGTCTGCAACACTTCCAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-239s1c1
Sequence:CCGGCACCATCGTGTGCAACAGCAACTCGAGTTGCTGTTGCACACGATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-95s1c1
Sequence:CCGGCCTGAATCTCAAACCTGGAGACTCGAGTCTCCAGGTTTGAGATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002305.2-149s1c1
Sequence:CCGGCGCTAAGAGCTTCGTGCTGAACTCGAGTTCAGCACGAAGCTCTTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-217s21c1
Sequence:CCGGCAACCTGTGCCTGCACTTCAACTCGAGTTGAAGTGCAGGCACAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-348s21c1
Sequence:CCGGGTGTTGCAGAGGTGTGCATCACTCGAGTGATGCACACCTCTGCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002305.3-468s21c1
Sequence:CCGGACGGTGACTTCAAGATCAAATCTCGAGATTTGATCTTGAAGTCACCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)