EMAIL THIS PAGE TO A FRIEND

LGALS2

lectin, galactoside-binding, soluble, 2

47 Gene Product Result for
Synonyms: HL14
UniProtKB ID: P05162, Q6FGY4
Gene ID:
Human(3957) Summary: The protein encoded by this gene is a soluble beta-galactoside binding lectin. The encoded protein is found as a homodimer and can bind to lymphotoxin-alpha. A single nucleotide polymorphism in an intron of this gene can alter the transcriptional level of the protein, with a resultant increased risk of myocardial infarction. [provided by RefSeq, Jul 2008]
Mouse(107753) lectin, galactose-binding, soluble 2
Rat(171134) lectin, galactoside-binding, soluble, 2
chicken(425107) lectin, galactoside-binding, soluble, 2
dog(474514) lectin, galactoside-binding, soluble, 2
cow(511098) lectin, galactoside-binding, soluble, 2
domestic cat(101097906) lectin, galactoside-binding, soluble, 2
sheep(101118867) lectin, galactoside-binding, soluble, 2
domestic guinea pig(100732295) lectin, galactoside-binding, soluble, 2
naked mole-rat(101721229) lectin, galactoside-binding, soluble, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006498 Rosetta Predictions human pricing
NM_133599 Rosetta Predictions rat pricing
NM_025622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098286 predicted 262
2 SASI_Hs01_00098287 predicted 271
3 SASI_Hs01_00098288 predicted 266
4 SASI_Hs01_00098289 predicted 221
5 SASI_Hs01_00098290 predicted 250
6 SASI_Hs01_00098291 predicted 256
7 SASI_Hs01_00098293 predicted 224
8 SASI_Hs01_00098294 predicted 245
9 SASI_Hs01_00098295 predicted 233
10 SASI_Hs01_00098292 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133599 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071258 predicted 281
2 SASI_Rn01_00071259 predicted 295
3 SASI_Rn01_00071260 predicted 288
4 SASI_Rn01_00071261 predicted 395
5 SASI_Rn02_00267818 predicted 248
6 SASI_Rn01_00071262 predicted 381
7 SASI_Rn01_00071263 predicted 267
8 SASI_Rn01_00071264 predicted 287
9 SASI_Rn01_00071265 predicted 199
10 SASI_Rn01_00071266 predicted 313
11 SASI_Rn01_00071267 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069558 predicted 295
2 SASI_Mm01_00069559 predicted 286
3 SASI_Mm01_00069560 predicted 265
4 SASI_Mm01_00069562 predicted 298
5 SASI_Mm02_00328675 predicted 312
6 SASI_Mm02_00328676 predicted 303
7 SASI_Mm01_00069563 predicted 298
8 SASI_Mm01_00069564 predicted 315
9 SASI_Mm01_00069565 predicted 195
10 SASI_Mm02_00328677 predicted 282
11 SASI_Mm01_00069561 predicted 302
12 SASI_Mm01_00069566 predicted 312
13 SASI_Mm01_00069567 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025622
VALIDATED
LGALS2 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025622.1-383s1c1
Sequence:CCGGCCACAACCAACTGCACTACTTCTCGAGAAGTAGTGCAGTTGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-382s21c1
Sequence:CCGGCCACAACCAACTGCACTACTTCTCGAGAAGTAGTGCAGTTGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-314s1c1
Sequence:CCGGCTTCCAAGATAAAGACTTCAACTCGAGTTGAAGTCTTTATCTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025622.1-198s1c1
Sequence:CCGGCGCTTCGATGAATCCACCATTCTCGAGAATGGTGGATTCATCGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-101s1c1
Sequence:CCGGGTCCCTGAAGATTAAAGGCAACTCGAGTTGCCTTTAATCTTCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-313s21c1
Sequence:CCGGCTTCCAAGATAAAGACTTCAACTCGAGTTGAAGTCTTTATCTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-80s1c1
Sequence:CCGGCCTGAACATGAAACCAGGGATCTCGAGATCCCTGGTTTCATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-79s21c1
Sequence:CCGGCCTGAACATGAAACCAGGGATCTCGAGATCCCTGGTTTCATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-197s21c1
Sequence:CCGGCGCTTCGATGAATCCACCATTCTCGAGAATGGTGGATTCATCGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-100s21c1
Sequence:CCGGGTCCCTGAAGATTAAAGGCAACTCGAGTTGCCTTTAATCTTCAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025622
VALIDATED
LGALS2 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025622.1-383s1c1
Sequence:CCGGCCACAACCAACTGCACTACTTCTCGAGAAGTAGTGCAGTTGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-382s21c1
Sequence:CCGGCCACAACCAACTGCACTACTTCTCGAGAAGTAGTGCAGTTGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-314s1c1
Sequence:CCGGCTTCCAAGATAAAGACTTCAACTCGAGTTGAAGTCTTTATCTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025622.1-198s1c1
Sequence:CCGGCGCTTCGATGAATCCACCATTCTCGAGAATGGTGGATTCATCGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-101s1c1
Sequence:CCGGGTCCCTGAAGATTAAAGGCAACTCGAGTTGCCTTTAATCTTCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-313s21c1
Sequence:CCGGCTTCCAAGATAAAGACTTCAACTCGAGTTGAAGTCTTTATCTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-80s1c1
Sequence:CCGGCCTGAACATGAAACCAGGGATCTCGAGATCCCTGGTTTCATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-79s21c1
Sequence:CCGGCCTGAACATGAAACCAGGGATCTCGAGATCCCTGGTTTCATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-197s21c1
Sequence:CCGGCGCTTCGATGAATCCACCATTCTCGAGAATGGTGGATTCATCGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-100s21c1
Sequence:CCGGGTCCCTGAAGATTAAAGGCAACTCGAGTTGCCTTTAATCTTCAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025622
VALIDATED
LGALS2 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025622.1-383s1c1
Sequence:CCGGCCACAACCAACTGCACTACTTCTCGAGAAGTAGTGCAGTTGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-382s21c1
Sequence:CCGGCCACAACCAACTGCACTACTTCTCGAGAAGTAGTGCAGTTGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-314s1c1
Sequence:CCGGCTTCCAAGATAAAGACTTCAACTCGAGTTGAAGTCTTTATCTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025622.1-198s1c1
Sequence:CCGGCGCTTCGATGAATCCACCATTCTCGAGAATGGTGGATTCATCGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-101s1c1
Sequence:CCGGGTCCCTGAAGATTAAAGGCAACTCGAGTTGCCTTTAATCTTCAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-313s21c1
Sequence:CCGGCTTCCAAGATAAAGACTTCAACTCGAGTTGAAGTCTTTATCTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025622.1-80s1c1
Sequence:CCGGCCTGAACATGAAACCAGGGATCTCGAGATCCCTGGTTTCATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-79s21c1
Sequence:CCGGCCTGAACATGAAACCAGGGATCTCGAGATCCCTGGTTTCATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-197s21c1
Sequence:CCGGCGCTTCGATGAATCCACCATTCTCGAGAATGGTGGATTCATCGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025622.2-100s21c1
Sequence:CCGGGTCCCTGAAGATTAAAGGCAACTCGAGTTGCCTTTAATCTTCAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006498
LGALS2 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-308s21c1
Sequence:CCGGGGGCAAGAACAACGGGAAGATCTCGAGATCTTCCCGTTGTTCTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-163s1c1
Sequence:CCGGCCTGAAGATCACAGGCAGCATCTCGAGATGCTGCCTGTGATCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-270s1c1
Sequence:CCGGCCACCATTGTCTGCAACTCATCTCGAGATGAGTTGCAGACAATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-379s1c1
Sequence:CCGGGAGTGACAAATTCAAGGTGAACTCGAGTTCACCTTGAATTTGTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-188s1c1
Sequence:CCGGGATGGCACTGATGGCTTTGTACTCGAGTACAAAGCCATCAGTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-356s1c1
Sequence:CCGGGTCAAGTTCACAGTGACCTTTCTCGAGAAAGGTCACTGTGAACTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-230s21c1
Sequence:CCGGGACAAGCTGAACCTGCATTTCCTCGAGGAAATGCAGGTTCAGCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-258s21c1
Sequence:CCGGGCTTCAGCGAATCCACCATTGCTCGAGCAATGGTGGATTCGCTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006498
LGALS2 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-308s21c1
Sequence:CCGGGGGCAAGAACAACGGGAAGATCTCGAGATCTTCCCGTTGTTCTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-163s1c1
Sequence:CCGGCCTGAAGATCACAGGCAGCATCTCGAGATGCTGCCTGTGATCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-270s1c1
Sequence:CCGGCCACCATTGTCTGCAACTCATCTCGAGATGAGTTGCAGACAATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-379s1c1
Sequence:CCGGGAGTGACAAATTCAAGGTGAACTCGAGTTCACCTTGAATTTGTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-188s1c1
Sequence:CCGGGATGGCACTGATGGCTTTGTACTCGAGTACAAAGCCATCAGTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-356s1c1
Sequence:CCGGGTCAAGTTCACAGTGACCTTTCTCGAGAAAGGTCACTGTGAACTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-230s21c1
Sequence:CCGGGACAAGCTGAACCTGCATTTCCTCGAGGAAATGCAGGTTCAGCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-258s21c1
Sequence:CCGGGCTTCAGCGAATCCACCATTGCTCGAGCAATGGTGGATTCGCTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006498
LGALS2 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-308s21c1
Sequence:CCGGGGGCAAGAACAACGGGAAGATCTCGAGATCTTCCCGTTGTTCTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-163s1c1
Sequence:CCGGCCTGAAGATCACAGGCAGCATCTCGAGATGCTGCCTGTGATCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-270s1c1
Sequence:CCGGCCACCATTGTCTGCAACTCATCTCGAGATGAGTTGCAGACAATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-379s1c1
Sequence:CCGGGAGTGACAAATTCAAGGTGAACTCGAGTTCACCTTGAATTTGTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-188s1c1
Sequence:CCGGGATGGCACTGATGGCTTTGTACTCGAGTACAAAGCCATCAGTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006498.2-356s1c1
Sequence:CCGGGTCAAGTTCACAGTGACCTTTCTCGAGAAAGGTCACTGTGAACTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-230s21c1
Sequence:CCGGGACAAGCTGAACCTGCATTTCCTCGAGGAAATGCAGGTTCAGCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006498.2-258s21c1
Sequence:CCGGGCTTCAGCGAATCCACCATTGCTCGAGCAATGGTGGATTCGCTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)