EMAIL THIS PAGE TO A FRIEND

LGALS3

lectin, galactoside-binding, soluble, 3

90 Gene Product Result for
Synonyms: CBP35 GAL3 GALBP GALIG L31 LGALS2 MAC2
UniProtKB ID: P17931, B2RC38, Q16005, Q6IBA7, Q96J47
Gene ID:
Human(3958) Summary: This gene encodes a member of the galectin family of carbohydrate binding proteins. Members of this protein family have an affinity for beta-galactosides. The encoded protein is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. This protein can self-associate through the N-terminal domain allowing it to bind to multivalent saccharide ligands. This protein localizes to the extracellular matrix, the cytoplasm and the nucleus. This protein plays a role in numerous cellular functions including apoptosis, innate immunity, cell adhesion and T-cell regulation. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
Mouse(16854) lectin, galactose binding, soluble 3
Rat(83781) lectin, galactoside-binding, soluble, 3
chicken(373917) lectin, galactoside-binding, soluble, 3
domestic cat(101081472) lectin, galactoside-binding, soluble, 3
cow(786492) lectin, galactoside-binding, soluble, 3
dog(404021) lectin, galactoside-binding, soluble, 3
domestic guinea pig(100736029) lectin, galactoside-binding, soluble, 3
naked mole-rat(101702345) lectin, galactoside-binding, soluble, 3
sheep(101118449) lectin, galactoside-binding, soluble, 3
Domestic Rabbit(100009187) lectin, galactoside-binding, soluble, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002306 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU006911 MISSION® esiRNA esiRNA targeting mouse Lgals3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002306 siRNAs that have been validated in the lab human pricing
NR_003225 Rosetta Predictions human pricing
NM_031832 Rosetta Predictions rat pricing
NM_010705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002306 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075642 validated 653
1 SASI_Hs01_00075643 validated 477
1 SASI_Hs01_00075645 validated 446
2 SASI_Hs02_00333614 predicted 414
3 SASI_Hs02_00333615 predicted 418
4 SASI_Hs01_00075647 predicted 621
5 SASI_Hs01_00075648 predicted 570
6 SASI_Hs02_00333616 predicted 491
7 SASI_Hs02_00333617 predicted 426
8 SASI_Hs02_00333618 predicted 626
9 SASI_Hs02_00333619 predicted 622
10 SASI_Hs02_00333620 predicted 352
11 SASI_Hs01_00075644 predicted 481
12 SASI_Hs01_00075646 predicted 538
13 SASI_Hs01_00075649 predicted 523
14 SASI_Hs01_00075650 predicted 465
15 SASI_Hs01_00075651 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378759 predicted 414
2 SASI_Hs02_00378760 predicted 829
3 SASI_Hs02_00378761 predicted 824
4 SASI_Hs02_00378762 predicted 510
5 SASI_Hs02_00378763 predicted 748
6 SASI_Hs02_00378764 predicted 815
7 SASI_Hs02_00378765 predicted 813
8 SASI_Hs02_00378766 predicted 740
9 SASI_Hs02_00378767 predicted 1104
10 SASI_Hs02_00378768 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118284 predicted 474
2 SASI_Rn01_00118286 predicted 707
3 SASI_Rn01_00118287 predicted 691
4 SASI_Rn01_00118288 predicted 226
5 SASI_Rn01_00118289 predicted 413
6 SASI_Rn01_00118290 predicted 404
7 SASI_Rn02_00265312 predicted 450
8 SASI_Rn01_00118291 predicted 714
9 SASI_Rn01_00118292 predicted 504
10 SASI_Rn01_00118293 predicted 226
11 SASI_Rn01_00118285 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319163 predicted 648
2 SASI_Mm01_00163135 predicted 1027
3 SASI_Mm01_00163137 predicted 1036
4 SASI_Mm01_00163138 predicted 487
5 SASI_Mm01_00163139 predicted 820
6 SASI_Mm01_00163141 predicted 971
7 SASI_Mm01_00163142 predicted 941
8 SASI_Mm01_00163143 predicted 802
9 SASI_Mm01_00163144 predicted 564
10 SASI_Mm02_00319164 predicted 982
11 SASI_Mm01_00163136 predicted 539
12 SASI_Mm01_00163140 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010705
LGALS3 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-523s21c1
Sequence:CCGGCCGCATGCTGATCACAATCATCTCGAGATGATTGTGATCAGCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-796s21c1
Sequence:CCGGGCAGTACAACCATCGGATGAACTCGAGTTCATCCGATGGTTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-557s21c1
Sequence:CCGGCCCAACGCAAACAGGATTGTTCTCGAGAACAATCCTGTTTGCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-565s1c1
Sequence:CCGGCCCGCTTCAATGAGAACAACACTCGAGTGTTGTTCTCATTGAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-501s1c1
Sequence:CCGGCCCAACGCAAACAGGATTGTTCTCGAGAACAATCCTGTTTGCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-711s21c1
Sequence:CCGGCCTTTGAGAGTGGCAAACCATCTCGAGATGGTTTGCCACTCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-467s1c1
Sequence:CCGGCCGCATGCTGATCACAATCATCTCGAGATGATTGTGATCAGCATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-740s1c1
Sequence:CCGGGCAGTACAACCATCGGATGAACTCGAGTTCATCCGATGGTTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-655s1c1
Sequence:CCGGCCTTTGAGAGTGGCAAACCATCTCGAGATGGTTTGCCACTCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010705
LGALS3 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-523s21c1
Sequence:CCGGCCGCATGCTGATCACAATCATCTCGAGATGATTGTGATCAGCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-796s21c1
Sequence:CCGGGCAGTACAACCATCGGATGAACTCGAGTTCATCCGATGGTTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-557s21c1
Sequence:CCGGCCCAACGCAAACAGGATTGTTCTCGAGAACAATCCTGTTTGCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-565s1c1
Sequence:CCGGCCCGCTTCAATGAGAACAACACTCGAGTGTTGTTCTCATTGAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-501s1c1
Sequence:CCGGCCCAACGCAAACAGGATTGTTCTCGAGAACAATCCTGTTTGCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-711s21c1
Sequence:CCGGCCTTTGAGAGTGGCAAACCATCTCGAGATGGTTTGCCACTCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-467s1c1
Sequence:CCGGCCGCATGCTGATCACAATCATCTCGAGATGATTGTGATCAGCATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-740s1c1
Sequence:CCGGGCAGTACAACCATCGGATGAACTCGAGTTCATCCGATGGTTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-655s1c1
Sequence:CCGGCCTTTGAGAGTGGCAAACCATCTCGAGATGGTTTGCCACTCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010705
LGALS3 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-523s21c1
Sequence:CCGGCCGCATGCTGATCACAATCATCTCGAGATGATTGTGATCAGCATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-796s21c1
Sequence:CCGGGCAGTACAACCATCGGATGAACTCGAGTTCATCCGATGGTTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-557s21c1
Sequence:CCGGCCCAACGCAAACAGGATTGTTCTCGAGAACAATCCTGTTTGCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-565s1c1
Sequence:CCGGCCCGCTTCAATGAGAACAACACTCGAGTGTTGTTCTCATTGAAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-501s1c1
Sequence:CCGGCCCAACGCAAACAGGATTGTTCTCGAGAACAATCCTGTTTGCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010705.3-711s21c1
Sequence:CCGGCCTTTGAGAGTGGCAAACCATCTCGAGATGGTTTGCCACTCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-467s1c1
Sequence:CCGGCCGCATGCTGATCACAATCATCTCGAGATGATTGTGATCAGCATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-740s1c1
Sequence:CCGGGCAGTACAACCATCGGATGAACTCGAGTTCATCCGATGGTTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010705.1-655s1c1
Sequence:CCGGCCTTTGAGAGTGGCAAACCATCTCGAGATGGTTTGCCACTCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002306
VALIDATED
LGALS3 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-536s1c1
Sequence:CCGGGCAATACAAAGCTGGATAATACTCGAGTATTATCCAGCTTTGTATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-442s1c1
Sequence:CCGGGCAAACAGAATTGCTTTAGATCTCGAGATCTAAAGCAATTCTGTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-675s1c1
Sequence:CCGGGCAGTACAATCATCGGGTTAACTCGAGTTAACCCGATGATTGTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-498s1c1
Sequence:CCGGCCCACGCTTCAATGAGAACAACTCGAGTTGTTCTCATTGAAGCGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-664s1c1
Sequence:CCGGGCTCACTTGTTGCAGTACAATCTCGAGATTGTACTGCAACAAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002306
VALIDATED
LGALS3 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-536s1c1
Sequence:CCGGGCAATACAAAGCTGGATAATACTCGAGTATTATCCAGCTTTGTATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-442s1c1
Sequence:CCGGGCAAACAGAATTGCTTTAGATCTCGAGATCTAAAGCAATTCTGTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-675s1c1
Sequence:CCGGGCAGTACAATCATCGGGTTAACTCGAGTTAACCCGATGATTGTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-498s1c1
Sequence:CCGGCCCACGCTTCAATGAGAACAACTCGAGTTGTTCTCATTGAAGCGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-664s1c1
Sequence:CCGGGCTCACTTGTTGCAGTACAATCTCGAGATTGTACTGCAACAAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002306
VALIDATED
LGALS3 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-536s1c1
Sequence:CCGGGCAATACAAAGCTGGATAATACTCGAGTATTATCCAGCTTTGTATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-442s1c1
Sequence:CCGGGCAAACAGAATTGCTTTAGATCTCGAGATCTAAAGCAATTCTGTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-675s1c1
Sequence:CCGGGCAGTACAATCATCGGGTTAACTCGAGTTAACCCGATGATTGTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-498s1c1
Sequence:CCGGCCCACGCTTCAATGAGAACAACTCGAGTTGTTCTCATTGAAGCGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002306.1-664s1c1
Sequence:CCGGGCTCACTTGTTGCAGTACAATCTCGAGATTGTACTGCAACAAGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)