EMAIL THIS PAGE TO A FRIEND

LGALS3BP

lectin, galactoside-binding, soluble, 3 binding protein

66 Gene Product Result for
Synonyms: 90K BTBD17B MAC-2-BP TANGO10B
UniProtKB ID: Q08380, Q7M4S0, Q9UCH8, Q9UCH9, Q9UCI0
Gene ID:
Human(3959) Summary: The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. LGALS3BP has been found elevated in the serum of patients with cancer and in those infected by the human immunodeficiency virus (HIV). It appears to be implicated in immune response associated with natural killer (NK) and lymphokine-activated killer (LAK) cell cytotoxicity. Using fluorescence in situ hybridization the full length 90K cDNA has been localized to chromosome 17q25. The native protein binds specifically to a human macrophage-associated lectin known as Mac-2 and also binds galectin 1. [provided by RefSeq, Jul 2008]
Mouse(19039) lectin, galactoside-binding, soluble, 3 binding protein
Rat(245955) lectin, galactoside-binding, soluble, 3 binding protein
sheep(101112495) lectin, galactoside-binding, soluble, 3 binding protein
Domestic Rabbit(100352316) lectin, galactoside-binding, soluble, 3 binding protein
domestic guinea pig(100732182) lectin, galactoside-binding, soluble, 3 binding protein
naked mole-rat(101708029) lectin, galactoside-binding, soluble, 3 binding protein
cow(531137) lectin, galactoside-binding, soluble, 3 binding protein
Horse(100050573) lectin, galactoside-binding, soluble, 3 binding protein
dog(483345) lectin, galactoside-binding, soluble, 3 binding protein
domestic cat(101083816) lectin, galactoside-binding, soluble, 3 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0929 AQUA Peptide LASAYGATELQDYCG[R] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005567 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005567 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005567 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005567 Rosetta Predictions human pricing
NM_139096 Rosetta Predictions rat pricing
NM_011150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005567 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339835 predicted 529
2 SASI_Hs02_00339836 predicted 537
3 SASI_Hs01_00162011 predicted 757
4 SASI_Hs02_00339837 predicted 531
5 SASI_Hs01_00162014 predicted 644
6 SASI_Hs02_00339838 predicted 464
7 SASI_Hs02_00339839 predicted 1233
8 SASI_Hs01_00162018 predicted 229
9 SASI_Hs02_00339840 predicted 634
10 SASI_Hs02_00339841 predicted 814
11 SASI_Hs01_00162009 predicted 1401
12 SASI_Hs01_00162010 predicted 799
13 SASI_Hs01_00162012 predicted 1350
14 SASI_Hs01_00162013 predicted 1353
15 SASI_Hs01_00162015 predicted 1782
16 SASI_Hs01_00162016 predicted 850
17 SASI_Hs01_00162017 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119186 predicted 343
2 SASI_Rn01_00119188 predicted 399
3 SASI_Rn01_00119189 predicted 1220
4 SASI_Rn01_00119190 predicted 212
5 SASI_Rn01_00119191 predicted 868
6 SASI_Rn01_00119192 predicted 1439
7 SASI_Rn01_00119193 predicted 1427
8 SASI_Rn01_00119194 predicted 1367
9 SASI_Rn01_00119195 predicted 666
10 SASI_Rn02_00268465 predicted 1184
11 SASI_Rn01_00119187 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034491 predicted 1445
2 SASI_Mm01_00034492 predicted 627
3 SASI_Mm01_00034493 predicted 1869
4 SASI_Mm01_00034494 predicted 784
5 SASI_Mm02_00320010 predicted 312
6 SASI_Mm01_00034495 predicted 1882
7 SASI_Mm01_00034496 predicted 930
8 SASI_Mm01_00034497 predicted 231
9 SASI_Mm01_00034499 predicted 1833
10 SASI_Mm02_00320011 predicted 1888
11 SASI_Mm01_00034498 predicted 1463
12 SASI_Mm01_00034500 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005567
LGALS3BP MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 3 binding protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005567.3-2068s21c1
Sequence:CCGGGAGCGCTCAGCTTCAAGAAATCTCGAGATTTCTTGAAGCTGAGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005567.3-1717s21c1
Sequence:CCGGATCGCACCATTGCCTACGAAACTCGAGTTTCGTAGGCAATGGTGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005567.3-539s21c1
Sequence:CCGGTGTGGTCTGCACCAATGAAACCTCGAGGTTTCATTGGTGCAGACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-1820s1c1
Sequence:CCGGCCTGGACACCAACAGCTCGAACTCGAGTTCGAGCTGTTGGTGTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-845s1c1
Sequence:CCGGGTCAGTCAAGTGCTTCCACAACTCGAGTTGTGGAAGCACTTGACTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-809s1c1
Sequence:CCGGGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-638s1c1
Sequence:CCGGCGACCTGTCCATCAGCGTGAACTCGAGTTCACGCTGATGGACAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-1455s1c1
Sequence:CCGGCGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005567
LGALS3BP MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 3 binding protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005567.3-2068s21c1
Sequence:CCGGGAGCGCTCAGCTTCAAGAAATCTCGAGATTTCTTGAAGCTGAGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005567.3-1717s21c1
Sequence:CCGGATCGCACCATTGCCTACGAAACTCGAGTTTCGTAGGCAATGGTGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005567.3-539s21c1
Sequence:CCGGTGTGGTCTGCACCAATGAAACCTCGAGGTTTCATTGGTGCAGACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-1820s1c1
Sequence:CCGGCCTGGACACCAACAGCTCGAACTCGAGTTCGAGCTGTTGGTGTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-845s1c1
Sequence:CCGGGTCAGTCAAGTGCTTCCACAACTCGAGTTGTGGAAGCACTTGACTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-809s1c1
Sequence:CCGGGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-638s1c1
Sequence:CCGGCGACCTGTCCATCAGCGTGAACTCGAGTTCACGCTGATGGACAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-1455s1c1
Sequence:CCGGCGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005567
LGALS3BP MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 3 binding protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005567.3-2068s21c1
Sequence:CCGGGAGCGCTCAGCTTCAAGAAATCTCGAGATTTCTTGAAGCTGAGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005567.3-1717s21c1
Sequence:CCGGATCGCACCATTGCCTACGAAACTCGAGTTTCGTAGGCAATGGTGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005567.3-539s21c1
Sequence:CCGGTGTGGTCTGCACCAATGAAACCTCGAGGTTTCATTGGTGCAGACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-1820s1c1
Sequence:CCGGCCTGGACACCAACAGCTCGAACTCGAGTTCGAGCTGTTGGTGTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-845s1c1
Sequence:CCGGGTCAGTCAAGTGCTTCCACAACTCGAGTTGTGGAAGCACTTGACTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-809s1c1
Sequence:CCGGGTACTTCTACTCCCGAAGGATCTCGAGATCCTTCGGGAGTAGAAGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-638s1c1
Sequence:CCGGCGACCTGTCCATCAGCGTGAACTCGAGTTCACGCTGATGGACAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005567.2-1455s1c1
Sequence:CCGGCGGAAGTCACAACTGGTCTATCTCGAGATAGACCAGTTGTGACTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011150
VALIDATED
LGALS3BP MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 3 binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-1785s21c1
Sequence:CCGGCCTGGACACCAATAGTTCCAACTCGAGTTGGAACTATTGGTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-1462s21c1
Sequence:CCGGCGATACAATCAGCTCTATACACTCGAGTGTATAGAGCTGATTGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-408s21c1
Sequence:CCGGGCCAGGAAAGGGACCGATCATCTCGAGATGATCGGTCCCTTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011150.2-1957s21c1
Sequence:CCGGCCAGCTGCTTTGTAAGCATAACTCGAGTTATGCTTACAAAGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011150.1-1462s1c1
Sequence:CCGGCGATACAATCAGCTCTATACACTCGAGTGTATAGAGCTGATTGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1957s1c1
Sequence:CCGGCCAGCTGCTTTGTAAGCATAACTCGAGTTATGCTTACAAAGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1875s1c1
Sequence:CCGGCCTCACTAACTCCACTGACATCTCGAGATGTCAGTGGAGTTAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-408s1c1
Sequence:CCGGGCCAGGAAAGGGACCGATCATCTCGAGATGATCGGTCCCTTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1785s1c1
Sequence:CCGGCCTGGACACCAATAGTTCCAACTCGAGTTGGAACTATTGGTGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011150
VALIDATED
LGALS3BP MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 3 binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-1785s21c1
Sequence:CCGGCCTGGACACCAATAGTTCCAACTCGAGTTGGAACTATTGGTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-1462s21c1
Sequence:CCGGCGATACAATCAGCTCTATACACTCGAGTGTATAGAGCTGATTGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-408s21c1
Sequence:CCGGGCCAGGAAAGGGACCGATCATCTCGAGATGATCGGTCCCTTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011150.2-1957s21c1
Sequence:CCGGCCAGCTGCTTTGTAAGCATAACTCGAGTTATGCTTACAAAGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011150.1-1462s1c1
Sequence:CCGGCGATACAATCAGCTCTATACACTCGAGTGTATAGAGCTGATTGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1957s1c1
Sequence:CCGGCCAGCTGCTTTGTAAGCATAACTCGAGTTATGCTTACAAAGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1875s1c1
Sequence:CCGGCCTCACTAACTCCACTGACATCTCGAGATGTCAGTGGAGTTAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-408s1c1
Sequence:CCGGGCCAGGAAAGGGACCGATCATCTCGAGATGATCGGTCCCTTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1785s1c1
Sequence:CCGGCCTGGACACCAATAGTTCCAACTCGAGTTGGAACTATTGGTGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011150
VALIDATED
LGALS3BP MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 3 binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-1785s21c1
Sequence:CCGGCCTGGACACCAATAGTTCCAACTCGAGTTGGAACTATTGGTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-1462s21c1
Sequence:CCGGCGATACAATCAGCTCTATACACTCGAGTGTATAGAGCTGATTGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011150.2-408s21c1
Sequence:CCGGGCCAGGAAAGGGACCGATCATCTCGAGATGATCGGTCCCTTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011150.2-1957s21c1
Sequence:CCGGCCAGCTGCTTTGTAAGCATAACTCGAGTTATGCTTACAAAGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011150.1-1462s1c1
Sequence:CCGGCGATACAATCAGCTCTATACACTCGAGTGTATAGAGCTGATTGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1957s1c1
Sequence:CCGGCCAGCTGCTTTGTAAGCATAACTCGAGTTATGCTTACAAAGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1875s1c1
Sequence:CCGGCCTCACTAACTCCACTGACATCTCGAGATGTCAGTGGAGTTAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-408s1c1
Sequence:CCGGGCCAGGAAAGGGACCGATCATCTCGAGATGATCGGTCCCTTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011150.1-1785s1c1
Sequence:CCGGCCTGGACACCAATAGTTCCAACTCGAGTTGGAACTATTGGTGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)