EMAIL THIS PAGE TO A FRIEND

LGALS4

lectin, galactoside-binding, soluble, 4

66 Gene Product Result for
Synonyms: GAL4 L36LBP
UniProtKB ID: P56470
Gene ID:
Human(3960) Summary: The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The expression of this gene is restricted to small intestine, colon, and rectum, and it is underexpressed in colorectal cancer. [provided by RefSeq, Jul 2008]
Mouse(16855) lectin, galactose binding, soluble 4
Rat(25474) lectin, galactoside-binding, soluble, 4
cow(614804) lectin, galactoside-binding, soluble, 4
domestic cat(101100170) lectin, galactoside-binding, soluble, 4
dog(484521) lectin, galactoside-binding, soluble, 4
domestic guinea pig(100729249) lectin, galactoside-binding, soluble, 4
naked mole-rat(101712316) lectin, galactoside-binding, soluble, 4
sheep(101112503) lectin, galactoside-binding, soluble, 4
Domestic Rabbit(100009464) lectin, galactoside-binding, soluble, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501748 Anti-LEG4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB2701172 Anti-LGALS4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2701603 Anti-LGALS4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB2701607 Anti-LGALS4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
western blot pricing
SAB2106582 Anti-LGALS4 antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, mouse, rabbit
ELISA, western blot pricing
HPA031184 Anti-LGALS4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031185 Anti-LGALS4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031186 Anti-LGALS4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1401230 Monoclonal Anti-LGALS4 antibody produced in mouse clone 1E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006149 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006149 Rosetta Predictions human pricing
NM_012975 Rosetta Predictions rat pricing
NM_010706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074103 predicted 702
2 SASI_Hs01_00074104 predicted 381
3 SASI_Hs01_00074105 predicted 380
4 SASI_Hs01_00074106 predicted 700
5 SASI_Hs02_00340986 predicted 849
6 SASI_Hs01_00074108 predicted 480
7 SASI_Hs01_00074109 predicted 848
8 SASI_Hs01_00074110 predicted 220
9 SASI_Hs01_00074111 predicted 845
10 SASI_Hs01_00074112 predicted 475
11 SASI_Hs01_00074107 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057938 predicted 333
2 SASI_Rn01_00057939 predicted 361
3 SASI_Rn01_00057940 predicted 804
4 SASI_Rn01_00057941 predicted 397
5 SASI_Rn01_00057942 predicted 476
6 SASI_Rn01_00057943 predicted 730
7 SASI_Rn01_00057944 predicted 478
8 SASI_Rn01_00057945 predicted 750
9 SASI_Rn01_00057946 predicted 359
10 SASI_Rn01_00057947 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114321 predicted 585
2 SASI_Mm01_00114323 predicted 683
3 SASI_Mm01_00114324 predicted 946
4 SASI_Mm01_00114325 predicted 222
5 SASI_Mm01_00114326 predicted 490
6 SASI_Mm02_00319165 predicted 285
7 SASI_Mm01_00114327 predicted 1008
8 SASI_Mm01_00114328 predicted 584
9 SASI_Mm01_00114329 predicted 281
10 SASI_Mm01_00114330 predicted 836
11 SASI_Mm01_00114322 predicted 547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010706
LGALS4 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-552s1c1
Sequence:CCGGCGGAAATTCCTTCTATGAATACTCGAGTATTCATAGAAGGAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-683s1c1
Sequence:CCGGGAGCCATGACTATTCCAGCTTCTCGAGAAGCTGGAATAGTCATGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-825s1c1
Sequence:CCGGCCGAAGAACCATCATAATCAACTCGAGTTGATTATGATGGTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-624s1c1
Sequence:CCGGCCTGGAACTTCAGTCCATCAACTCGAGTTGATGGACTGAAGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-431s1c1
Sequence:CCGGACACGATGCAAAGTGGACAATCTCGAGATTGTCCACTTTGCATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010706
LGALS4 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-552s1c1
Sequence:CCGGCGGAAATTCCTTCTATGAATACTCGAGTATTCATAGAAGGAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-683s1c1
Sequence:CCGGGAGCCATGACTATTCCAGCTTCTCGAGAAGCTGGAATAGTCATGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-825s1c1
Sequence:CCGGCCGAAGAACCATCATAATCAACTCGAGTTGATTATGATGGTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-624s1c1
Sequence:CCGGCCTGGAACTTCAGTCCATCAACTCGAGTTGATGGACTGAAGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-431s1c1
Sequence:CCGGACACGATGCAAAGTGGACAATCTCGAGATTGTCCACTTTGCATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010706
LGALS4 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-552s1c1
Sequence:CCGGCGGAAATTCCTTCTATGAATACTCGAGTATTCATAGAAGGAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-683s1c1
Sequence:CCGGGAGCCATGACTATTCCAGCTTCTCGAGAAGCTGGAATAGTCATGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-825s1c1
Sequence:CCGGCCGAAGAACCATCATAATCAACTCGAGTTGATTATGATGGTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-624s1c1
Sequence:CCGGCCTGGAACTTCAGTCCATCAACTCGAGTTGATGGACTGAAGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010706.1-431s1c1
Sequence:CCGGACACGATGCAAAGTGGACAATCTCGAGATTGTCCACTTTGCATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006149
LGALS4 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-482s1c1
Sequence:CCGGGCAACTTCAATCAATCAACTTCTCGAGAAGTTGATTGATTGAAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-870s1c1
Sequence:CCGGCAGTTCTTTGATCTGTCCATTCTCGAGAATGGACAGATCAAAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-665s1c1
Sequence:CCGGAGCTCGAAGAACCATCATCATCTCGAGATGATGATGGTTCTTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-185s1c1
Sequence:CCGGGAAGCGGTTCTTCGTGAACTTCTCGAGAAGTTCACGAAGAACCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006149
LGALS4 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-482s1c1
Sequence:CCGGGCAACTTCAATCAATCAACTTCTCGAGAAGTTGATTGATTGAAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-870s1c1
Sequence:CCGGCAGTTCTTTGATCTGTCCATTCTCGAGAATGGACAGATCAAAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-665s1c1
Sequence:CCGGAGCTCGAAGAACCATCATCATCTCGAGATGATGATGGTTCTTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-185s1c1
Sequence:CCGGGAAGCGGTTCTTCGTGAACTTCTCGAGAAGTTCACGAAGAACCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006149
LGALS4 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-482s1c1
Sequence:CCGGGCAACTTCAATCAATCAACTTCTCGAGAAGTTGATTGATTGAAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-870s1c1
Sequence:CCGGCAGTTCTTTGATCTGTCCATTCTCGAGAATGGACAGATCAAAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-665s1c1
Sequence:CCGGAGCTCGAAGAACCATCATCATCTCGAGATGATGATGGTTCTTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006149.2-185s1c1
Sequence:CCGGGAAGCGGTTCTTCGTGAACTTCTCGAGAAGTTCACGAAGAACCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)