EMAIL THIS PAGE TO A FRIEND

LGALS7

lectin, galactoside-binding, soluble, 7

68 Gene Product Result for
Synonyms: GAL7 LGALS7A
UniProtKB ID: P47929, Q6IB87
Gene ID:
Human(3963) Summary: The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Differential and in situ hybridization studies indicate that this lectin is specifically expressed in keratinocytes and found mainly in stratified squamous epithelium. A duplicate copy of this gene (GeneID:653499) is found adjacent to, but on the opposite strand on chromosome 19. [provided by RefSeq, Jul 2008]
Mouse(16858) lectin, galactose binding, soluble 7
Rat(29518) lectin, galactoside-binding, soluble, 7
sheep(101111992) lectin, galactoside-binding, soluble, 7
domestic guinea pig(100728410) lectin, galactoside-binding, soluble, 7
naked mole-rat(101711963) lectin, galactoside-binding, soluble, 7
dog(100686799) lectin, galactoside-binding, soluble, 7
cow(787811) lectin, galactoside-binding, soluble, 7
domestic cat(101100684) lectin, galactoside-binding, soluble, 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002307 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU037661 MISSION® esiRNA esiRNA targeting mouse Lgals7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002307 Rosetta Predictions human pricing
NM_022582 Rosetta Predictions rat pricing
XM_579459 Rosetta Predictions rat pricing
NM_008496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222897 predicted 232
2 SASI_Hs01_00222900 predicted 264
3 SASI_Hs01_00222901 predicted 230
4 SASI_Hs01_00222903 predicted 234
5 SASI_Hs01_00222904 predicted 230
6 SASI_Hs01_00222906 predicted 235
7 SASI_Hs02_00333621 predicted 53
8 SASI_Hs02_00333622 predicted 144
9 SASI_Hs02_00333623 predicted 50
10 SASI_Hs02_00333624 predicted 142
11 SASI_Hs01_00222898 predicted 202
12 SASI_Hs01_00222899 predicted 202
13 SASI_Hs01_00222902 predicted 209
14 SASI_Hs01_00222905 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113922 predicted 253
2 SASI_Rn01_00113923 predicted 248
3 SASI_Rn01_00113924 predicted 247
4 SASI_Rn01_00113925 predicted 247
5 SASI_Rn01_00113926 predicted 283
6 SASI_Rn01_00113927 predicted 277
7 SASI_Rn01_00113929 predicted 254
8 SASI_Rn01_00113930 predicted 252
9 SASI_Rn02_00263323 predicted 243
10 SASI_Rn02_00263324 predicted 251
11 SASI_Rn01_00113921 predicted 199
12 SASI_Rn01_00113928 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579459 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143317 predicted 263
2 SASI_Rn01_00143318 predicted 252
3 SASI_Rn01_00143319 predicted 260
4 SASI_Rn01_00143320 predicted 252
5 SASI_Rn01_00143321 predicted 281
6 SASI_Rn01_00143322 predicted 285
7 SASI_Rn01_00143323 predicted 262
8 SASI_Rn01_00143324 predicted 262
9 SASI_Rn01_00143325 predicted 255
10 SASI_Rn01_00143326 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314046 predicted 351
2 SASI_Mm01_00106418 predicted 255
3 SASI_Mm01_00106419 predicted 221
4 SASI_Mm01_00106420 predicted 260
5 SASI_Mm01_00106421 predicted 233
6 SASI_Mm02_00314047 predicted 224
7 SASI_Mm01_00106422 predicted 224
8 SASI_Mm01_00106423 predicted 260
9 SASI_Mm01_00106424 predicted 256
10 SASI_Mm01_00106425 predicted 332
11 SASI_Mm01_00106426 predicted 240
12 SASI_Mm01_00106427 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008496
LGALS7 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-347s1c2
Sequence:CCGGGCAGCCCTTTGAAGTGCTCCTCTCGAGAGGAGCACTTCAAAGGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-270s1c1
Sequence:CCGGGAGGTTGTCTTCAACACCAAACTCGAGTTTGGTGTTGAAGACAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-141s1c1
Sequence:CCGGGTGGGCACTGTCATGAGAATTCTCGAGAATTCTCATGACAGTGCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-189s1c1
Sequence:CCGGAGGTTCCATGTAAACCTGCTACTCGAGTAGCAGGTTTACATGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-407s1c1
Sequence:CCGGTGACGAATATCTCCACTTCCACTCGAGTGGAAGTGGAGATATTCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008496
LGALS7 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-347s1c2
Sequence:CCGGGCAGCCCTTTGAAGTGCTCCTCTCGAGAGGAGCACTTCAAAGGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-270s1c1
Sequence:CCGGGAGGTTGTCTTCAACACCAAACTCGAGTTTGGTGTTGAAGACAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-141s1c1
Sequence:CCGGGTGGGCACTGTCATGAGAATTCTCGAGAATTCTCATGACAGTGCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-189s1c1
Sequence:CCGGAGGTTCCATGTAAACCTGCTACTCGAGTAGCAGGTTTACATGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-407s1c1
Sequence:CCGGTGACGAATATCTCCACTTCCACTCGAGTGGAAGTGGAGATATTCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008496
LGALS7 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-347s1c2
Sequence:CCGGGCAGCCCTTTGAAGTGCTCCTCTCGAGAGGAGCACTTCAAAGGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-270s1c1
Sequence:CCGGGAGGTTGTCTTCAACACCAAACTCGAGTTTGGTGTTGAAGACAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-141s1c1
Sequence:CCGGGTGGGCACTGTCATGAGAATTCTCGAGAATTCTCATGACAGTGCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-189s1c1
Sequence:CCGGAGGTTCCATGTAAACCTGCTACTCGAGTAGCAGGTTTACATGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008496.4-407s1c1
Sequence:CCGGTGACGAATATCTCCACTTCCACTCGAGTGGAAGTGGAGATATTCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002307
LGALS7 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-116s1c1
Sequence:CCGGTGCCAGCAGGTTCCATGTAAACTCGAGTTTACATGGAACCTGCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-86s1c1
Sequence:CCGGGCTGAGAATTCGCGGCTTGGTCTCGAGACCAAGCCGCGAATTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-296s1c1
Sequence:CCGGGCTCATCATCGCGTCAGACGACTCGAGTCGTCTGACGCGATGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-315s1c1
Sequence:CCGGGACGGCTTCAAGGCCGTGGTTCTCGAGAACCACGGCCTTGAAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002307
LGALS7 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-116s1c1
Sequence:CCGGTGCCAGCAGGTTCCATGTAAACTCGAGTTTACATGGAACCTGCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-86s1c1
Sequence:CCGGGCTGAGAATTCGCGGCTTGGTCTCGAGACCAAGCCGCGAATTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-296s1c1
Sequence:CCGGGCTCATCATCGCGTCAGACGACTCGAGTCGTCTGACGCGATGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-315s1c1
Sequence:CCGGGACGGCTTCAAGGCCGTGGTTCTCGAGAACCACGGCCTTGAAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002307
LGALS7 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-116s1c1
Sequence:CCGGTGCCAGCAGGTTCCATGTAAACTCGAGTTTACATGGAACCTGCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-86s1c1
Sequence:CCGGGCTGAGAATTCGCGGCTTGGTCTCGAGACCAAGCCGCGAATTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-296s1c1
Sequence:CCGGGCTCATCATCGCGTCAGACGACTCGAGTCGTCTGACGCGATGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002307.1-315s1c1
Sequence:CCGGGACGGCTTCAAGGCCGTGGTTCTCGAGAACCACGGCCTTGAAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)