EMAIL THIS PAGE TO A FRIEND

LGALS7B

lectin, galactoside-binding, soluble, 7B

24 Gene Product Result for
Synonyms: GAL7 Gal-7 HKL-14 LGALS7 PI7
Gene ID:
Human(653499) Summary: The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Differential and in situ hybridization studies indicate that this lectin is specifically expressed in keratinocytes and found mainly in stratified squamous epithelium. A duplicate copy of this gene (GeneID:3963) is found adjacent to, but on the opposite strand on chromosome 19. [provided by RefSeq, Jul 2008]
cow(100298130) lectin, galactoside-binding, soluble, 7B
domestic cat(101100430) lectin, galactoside-binding, soluble, 7B
dog(100686721) lectin, galactoside-binding, soluble, 7B
domestic guinea pig(100728966) lectin, galactoside-binding, soluble, 7B
naked mole-rat(101726333) lectin, galactoside-binding, soluble, 7B
sheep(101112249) lectin, galactoside-binding, soluble, 7B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042507 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111911 MISSION® esiRNA esiRNA human LGALS7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042507 Rosetta Predictions human pricing
XM_927748 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310218 predicted 246
2 SASI_Hs02_00310219 predicted 199
3 SASI_Hs02_00310220 predicted 267
4 SASI_Hs02_00310221 predicted 244
5 SASI_Hs02_00310222 predicted 194
6 SASI_Hs02_00310223 predicted 275
7 SASI_Hs02_00310224 predicted 243
8 SASI_Hs02_00310225 predicted 239
9 SASI_Hs02_00310226 predicted 247
10 SASI_Hs02_00310227 predicted 63
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299958 predicted 244
2 SASI_Hs01_00299959 predicted 248
3 SASI_Hs01_00299960 predicted 244
4 SASI_Hs01_00299961 predicted 237
5 SASI_Hs01_00299962 predicted 242
6 SASI_Hs01_00299963 predicted 112
7 SASI_Hs01_00299964 predicted 66
8 SASI_Hs01_00299965 predicted 155
9 SASI_Hs01_00299966 predicted 271
10 SASI_Hs01_00299967 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042507
LGALS7B MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 7B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-272s21c1
Sequence:CCGGGCCCTTCGAGGTGCTCATCATCTCGAGATGATGAGCACCTCGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-285s21c1
Sequence:CCGGCTCATCATCGCGTCAGACGACCTCGAGGTCGTCTGACGCGATGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-199s21c1
Sequence:CCGGTCTTCAACAGCAAGGAGCAAGCTCGAGCTTGCTCCTTGCTGTTGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-185s21c1
Sequence:CCGGCACGTCGGAGGTGGTCTTCAACTCGAGTTGAAGACCACCTCCGACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-105s21c1
Sequence:CCGGGCCAGCAGGTTCCATGTAAACCTCGAGGTTTACATGGAACCTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042507
LGALS7B MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 7B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-272s21c1
Sequence:CCGGGCCCTTCGAGGTGCTCATCATCTCGAGATGATGAGCACCTCGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-285s21c1
Sequence:CCGGCTCATCATCGCGTCAGACGACCTCGAGGTCGTCTGACGCGATGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-199s21c1
Sequence:CCGGTCTTCAACAGCAAGGAGCAAGCTCGAGCTTGCTCCTTGCTGTTGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-185s21c1
Sequence:CCGGCACGTCGGAGGTGGTCTTCAACTCGAGTTGAAGACCACCTCCGACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-105s21c1
Sequence:CCGGGCCAGCAGGTTCCATGTAAACCTCGAGGTTTACATGGAACCTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042507
LGALS7B MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 7B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-272s21c1
Sequence:CCGGGCCCTTCGAGGTGCTCATCATCTCGAGATGATGAGCACCTCGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-285s21c1
Sequence:CCGGCTCATCATCGCGTCAGACGACCTCGAGGTCGTCTGACGCGATGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-199s21c1
Sequence:CCGGTCTTCAACAGCAAGGAGCAAGCTCGAGCTTGCTCCTTGCTGTTGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-185s21c1
Sequence:CCGGCACGTCGGAGGTGGTCTTCAACTCGAGTTGAAGACCACCTCCGACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042507.3-105s21c1
Sequence:CCGGGCCAGCAGGTTCCATGTAAACCTCGAGGTTTACATGGAACCTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)