EMAIL THIS PAGE TO A FRIEND

LGALS8

lectin, galactoside-binding, soluble, 8

111 Gene Product Result for
Synonyms: Gal-8 PCTA-1 PCTA1 Po66-CBP
Gene ID:
Human(3964) Summary: This gene encodes a member of the galectin family. Galectins are beta-galactoside-binding animal lectins with conserved carbohydrate recognition domains. The galectins have been implicated in many essential functions including development, differentiation, cell-cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing. This gene is widely expressed in tumoral tissues and seems to be involved in integrin-like cell interactions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(56048) lectin, galactose binding, soluble 8
Rat(116641) lectin, galactoside-binding, soluble, 8
sheep(101115850) lectin, galactoside-binding, soluble, 8
Domestic Rabbit(100343919) lectin, galactoside-binding, soluble, 8
domestic guinea pig(100733991) lectin, galactoside-binding, soluble, 8
naked mole-rat(101723029) lectin, galactoside-binding, soluble, 8
chicken(430948) lectin, galactoside-binding, soluble, 8
cow(506977) lectin, galactoside-binding, soluble, 8
domestic cat(101101669) lectin, galactoside-binding, soluble, 8
dog(479193) lectin, galactoside-binding, soluble, 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006499 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098291 MISSION® esiRNA esiRNA human LGALS8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006499 Rosetta Predictions human pricing
NM_201543 Rosetta Predictions human pricing
NM_201544 Rosetta Predictions human pricing
NM_201545 Rosetta Predictions human pricing
NM_053862 Rosetta Predictions rat pricing
NM_018886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167028 predicted 1440
2 SASI_Hs02_00341704 predicted 1396
3 SASI_Hs01_00167030 predicted 1351
4 SASI_Hs01_00167031 predicted 1283
5 SASI_Hs01_00167032 predicted 1394
6 SASI_Hs02_00341705 predicted 1430
7 SASI_Hs01_00167033 predicted 1423
8 SASI_Hs01_00167034 predicted 636
9 SASI_Hs01_00167035 predicted 1366
10 SASI_Hs02_00341706 predicted 1365
11 SASI_Hs01_00167029 predicted 1302
12 SASI_Hs01_00167036 predicted 565
13 SASI_Hs01_00167037 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079709 predicted 1314
2 SASI_Hs02_00373024 predicted 1272
3 SASI_Hs01_00079711 predicted 1227
4 SASI_Hs01_00079712 predicted 1156
5 SASI_Hs01_00079713 predicted 1265
6 SASI_Hs02_00373025 predicted 1300
7 SASI_Hs01_00079714 predicted 1291
8 SASI_Hs01_00079715 predicted 637
9 SASI_Hs01_00079716 predicted 1235
10 SASI_Hs02_00373026 predicted 1240
11 SASI_Hs01_00079710 predicted 1168
12 SASI_Hs01_00079717 predicted 559
13 SASI_Hs01_00079718 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012624 predicted 1319
2 SASI_Hs02_00373027 predicted 1281
3 SASI_Hs01_00012626 predicted 1231
4 SASI_Hs01_00012627 predicted 1164
5 SASI_Hs01_00012628 predicted 1272
6 SASI_Hs02_00373028 predicted 1310
7 SASI_Hs01_00012629 predicted 1303
8 SASI_Hs01_00012630 predicted 644
9 SASI_Hs01_00012631 predicted 1243
10 SASI_Hs02_00373029 predicted 1249
11 SASI_Hs01_00012625 predicted 1183
12 SASI_Hs01_00012632 predicted 567
13 SASI_Hs01_00012633 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123701 predicted 1265
2 SASI_Hs02_00373030 predicted 1216
3 SASI_Hs01_00123703 predicted 1167
4 SASI_Hs01_00123704 predicted 1097
5 SASI_Hs01_00123705 predicted 1215
6 SASI_Hs02_00373031 predicted 1241
7 SASI_Hs01_00123706 predicted 1237
8 SASI_Hs01_00123707 predicted 461
9 SASI_Hs01_00123708 predicted 1185
10 SASI_Hs02_00373032 predicted 1188
11 SASI_Hs01_00123702 predicted 1121
12 SASI_Hs01_00123709 predicted 379
13 SASI_Hs01_00123710 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088272 predicted 1159
2 SASI_Rn01_00088273 predicted 1050
3 SASI_Rn01_00088274 predicted 1172
4 SASI_Rn01_00088275 predicted 961
5 SASI_Rn01_00088276 predicted 1083
6 SASI_Rn01_00088277 predicted 733
7 SASI_Rn01_00088278 predicted 1129
8 SASI_Rn01_00088279 predicted 835
9 SASI_Rn01_00088281 predicted 686
10 SASI_Rn02_00266735 predicted 588
11 SASI_Rn01_00088280 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324302 predicted 872
2 SASI_Mm01_00148685 predicted 463
3 SASI_Mm01_00148686 predicted 1187
4 SASI_Mm01_00148687 predicted 982
5 SASI_Mm01_00148688 predicted 609
6 SASI_Mm02_00324303 predicted 662
7 SASI_Mm02_00324304 predicted 937
8 SASI_Mm01_00148689 predicted 345
9 SASI_Mm02_00324305 predicted 223
10 SASI_Mm01_00148691 predicted 1064
11 SASI_Mm01_00148690 predicted 1099
12 SASI_Mm01_00148692 predicted 978
13 SASI_Mm01_00148693 predicted 744
14 SASI_Mm01_00148694 predicted 956
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006499
VALIDATED
LGALS8 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006499.3-1741s21c1
Sequence:CCGGTATGGAGTACCTACTATAATACTCGAGTATTATAGTAGGTACTCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-411s21c1
Sequence:CCGGTATCATCTATAACCCGGTAATCTCGAGATTACCGGGTTATAGATGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006499.3-1931s21c1
Sequence:CCGGGGGTCCTCTGGGATTAGTTATCTCGAGATAACTAATCCCAGAGGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-1272s21c1
Sequence:CCGGTATTACCTCTTTCCCATTTAGCTCGAGCTAAATGGGAAAGAGGTAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-1361s21c1
Sequence:CCGGTACACAGCCTGGAGTACAAACCTCGAGGTTTGTACTCCAGGCTGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006499.3-1204s1c1
Sequence:CCGGCGCCTGAATATTAAAGCATTTCTCGAGAAATGCTTTAATATTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006499.3-987s1c1
Sequence:CCGGGAGCAAAGATTCGACTGTCAACTCGAGTTGACAGTCGAATCTTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-466s1c1
Sequence:CCGGCCTGGAACTTTGATTGTGATACTCGAGTATCACAATCAAAGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-806s1c1
Sequence:CCGGGCAAAGTGAATATTCACTCAACTCGAGTTGAGTGAATATTCACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-1413s1c1
Sequence:CCGGGCTGGAAATTAATGGAGACATCTCGAGATGTCTCCATTAATTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006499
VALIDATED
LGALS8 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006499.3-1741s21c1
Sequence:CCGGTATGGAGTACCTACTATAATACTCGAGTATTATAGTAGGTACTCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-411s21c1
Sequence:CCGGTATCATCTATAACCCGGTAATCTCGAGATTACCGGGTTATAGATGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006499.3-1931s21c1
Sequence:CCGGGGGTCCTCTGGGATTAGTTATCTCGAGATAACTAATCCCAGAGGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-1272s21c1
Sequence:CCGGTATTACCTCTTTCCCATTTAGCTCGAGCTAAATGGGAAAGAGGTAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-1361s21c1
Sequence:CCGGTACACAGCCTGGAGTACAAACCTCGAGGTTTGTACTCCAGGCTGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006499.3-1204s1c1
Sequence:CCGGCGCCTGAATATTAAAGCATTTCTCGAGAAATGCTTTAATATTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006499.3-987s1c1
Sequence:CCGGGAGCAAAGATTCGACTGTCAACTCGAGTTGACAGTCGAATCTTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-466s1c1
Sequence:CCGGCCTGGAACTTTGATTGTGATACTCGAGTATCACAATCAAAGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-806s1c1
Sequence:CCGGGCAAAGTGAATATTCACTCAACTCGAGTTGAGTGAATATTCACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-1413s1c1
Sequence:CCGGGCTGGAAATTAATGGAGACATCTCGAGATGTCTCCATTAATTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006499
VALIDATED
LGALS8 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006499.3-1741s21c1
Sequence:CCGGTATGGAGTACCTACTATAATACTCGAGTATTATAGTAGGTACTCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-411s21c1
Sequence:CCGGTATCATCTATAACCCGGTAATCTCGAGATTACCGGGTTATAGATGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006499.3-1931s21c1
Sequence:CCGGGGGTCCTCTGGGATTAGTTATCTCGAGATAACTAATCCCAGAGGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-1272s21c1
Sequence:CCGGTATTACCTCTTTCCCATTTAGCTCGAGCTAAATGGGAAAGAGGTAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006499.3-1361s21c1
Sequence:CCGGTACACAGCCTGGAGTACAAACCTCGAGGTTTGTACTCCAGGCTGTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006499.3-1204s1c1
Sequence:CCGGCGCCTGAATATTAAAGCATTTCTCGAGAAATGCTTTAATATTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006499.3-987s1c1
Sequence:CCGGGAGCAAAGATTCGACTGTCAACTCGAGTTGACAGTCGAATCTTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-466s1c1
Sequence:CCGGCCTGGAACTTTGATTGTGATACTCGAGTATCACAATCAAAGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-806s1c1
Sequence:CCGGGCAAAGTGAATATTCACTCAACTCGAGTTGAGTGAATATTCACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006499.3-1413s1c1
Sequence:CCGGGCTGGAAATTAATGGAGACATCTCGAGATGTCTCCATTAATTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018886
LGALS8 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1104s1c1
Sequence:CCGGCGGGAATTCAAGGTTGCTATACTCGAGTATAGCAACCTTGAATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1055s1c1
Sequence:CCGGCCCATTTAGTTCTGGGATGTACTCGAGTACATCCCAGAACTAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-395s1c1
Sequence:CCGGCCCTAAAGATTCAGAAAGATTCTCGAGAATCTTTCTGAATCTTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-834s1c1
Sequence:CCGGCCATTTGAAGCAAGGTTGAATCTCGAGATTCAACCTTGCTTCAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1167s1c1
Sequence:CCGGCTAAGCAGTATTGATACACTACTCGAGTAGTGTATCAATACTGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018886
LGALS8 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1104s1c1
Sequence:CCGGCGGGAATTCAAGGTTGCTATACTCGAGTATAGCAACCTTGAATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1055s1c1
Sequence:CCGGCCCATTTAGTTCTGGGATGTACTCGAGTACATCCCAGAACTAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-395s1c1
Sequence:CCGGCCCTAAAGATTCAGAAAGATTCTCGAGAATCTTTCTGAATCTTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-834s1c1
Sequence:CCGGCCATTTGAAGCAAGGTTGAATCTCGAGATTCAACCTTGCTTCAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1167s1c1
Sequence:CCGGCTAAGCAGTATTGATACACTACTCGAGTAGTGTATCAATACTGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018886
LGALS8 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1104s1c1
Sequence:CCGGCGGGAATTCAAGGTTGCTATACTCGAGTATAGCAACCTTGAATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1055s1c1
Sequence:CCGGCCCATTTAGTTCTGGGATGTACTCGAGTACATCCCAGAACTAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-395s1c1
Sequence:CCGGCCCTAAAGATTCAGAAAGATTCTCGAGAATCTTTCTGAATCTTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-834s1c1
Sequence:CCGGCCATTTGAAGCAAGGTTGAATCTCGAGATTCAACCTTGCTTCAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018886.2-1167s1c1
Sequence:CCGGCTAAGCAGTATTGATACACTACTCGAGTAGTGTATCAATACTGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)