EMAIL THIS PAGE TO A FRIEND

LGALS9

lectin, galactoside-binding, soluble, 9

49 Gene Product Result for
Synonyms: HUAT LGALS9A
Gene ID:
Human(3965) Summary: The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The protein encoded by this gene is an S-type lectin. It is overexpressed in Hodgkin's disease tissue and might participate in the interaction between the H&RS cells with their surrounding cells and might thus play a role in the pathogenesis of this disease and/or its associated immunodeficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16859) lectin, galactose binding, soluble 9
Rat(25476) lectin, galactoside-binding, soluble, 9
cow(100137897) lectin, galactoside-binding, soluble, 9
cow(510813) lectin, galactoside-binding, soluble, 9
domestic cat(101087280) lectin, galactoside-binding, soluble, 9
dog(442861) lectin, galactoside-binding, soluble, 9
naked mole-rat(101699033) lectin, galactoside-binding, soluble, 9
sheep(101102156) lectin, galactoside-binding, soluble, 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002308 Rosetta Predictions human pricing
NM_009587 Rosetta Predictions human pricing
NM_012977 Rosetta Predictions rat pricing
NM_010708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243481 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116670 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032656 predicted 689
2 SASI_Rn01_00032651 predicted 287
3 SASI_Rn01_00032652 predicted 786
4 SASI_Rn01_00032653 predicted 388
5 SASI_Rn01_00032655 predicted 398
6 SASI_Rn01_00032657 predicted 198
7 SASI_Rn01_00032658 predicted 287
8 SASI_Rn01_00032659 predicted 648
9 SASI_Rn01_00032660 predicted 233
10 SASI_Rn02_00260580 predicted 562
11 SASI_Rn01_00032654 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036311 predicted 732
2 SASI_Mm01_00036312 predicted 419
3 SASI_Mm01_00036313 predicted 582
4 SASI_Mm01_00036314 predicted 620
5 SASI_Mm01_00036315 predicted 408
6 SASI_Mm01_00036316 predicted 785
7 SASI_Mm01_00036317 predicted 753
8 SASI_Mm01_00036318 predicted 748
9 SASI_Mm01_00036319 predicted 214
10 SASI_Mm02_00319167 predicted 815
11 SASI_Mm01_00036310 predicted 785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010708
VALIDATED
LGALS9 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 9
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-669s1c1
Sequence:CCGGCCCAGCCTATACCATACCTTTCTCGAGAAAGGTATGGTATAGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010708.1-139s1c1
Sequence:CCGGCAAAGGTTTGTGGTGAACTTTCTCGAGAAAGTTCACCACAAACCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010708.1-584s1c1
Sequence:CCGGTGGCTCAAACTACCATCCATACTCGAGTATGGATGGTAGTTTGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-348s1c1
Sequence:CCGGGATGGTGAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-820s1c1
Sequence:CCGGCGTTTCAATGAGAATGCTGTTCTCGAGAACAGCATTCTCATTGAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010708.2-1202s21c1
Sequence:GTACCGGAGCACTCTGCCTGTGTCTTATCTCGAGATAAGACACAGGCAGAGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-441s21c1
Sequence:CCGGGATGGTGAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-762s21c1
Sequence:CCGGCCCAGCCTATACCATACCTTTCTCGAGAAAGGTATGGTATAGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010708.2-1174s21c1
Sequence:CCGGAGGTCTCTGGCCTAGGGATAACTCGAGTTATCCCTAGGCCAGAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-1016s21c1
Sequence:CCGGGCTTCTCGGTGTGGATCATATCTCGAGATATGATCCACACCGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-1125s21c1
Sequence:CCGGTCTAGAAGTGGCGGGTGATATCTCGAGATATCACCCGCCACTTCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010708.2-849s21c1
Sequence:GTACCGGAGATGCTACGAGGTTCCATATCTCGAGATATGGAACCTCGTAGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010708
VALIDATED
LGALS9 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 9
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-669s1c1
Sequence:CCGGCCCAGCCTATACCATACCTTTCTCGAGAAAGGTATGGTATAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010708.1-139s1c1
Sequence:CCGGCAAAGGTTTGTGGTGAACTTTCTCGAGAAAGTTCACCACAAACCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010708.1-584s1c1
Sequence:CCGGTGGCTCAAACTACCATCCATACTCGAGTATGGATGGTAGTTTGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-348s1c1
Sequence:CCGGGATGGTGAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-820s1c1
Sequence:CCGGCGTTTCAATGAGAATGCTGTTCTCGAGAACAGCATTCTCATTGAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010708.2-1202s21c1
Sequence:GTACCGGAGCACTCTGCCTGTGTCTTATCTCGAGATAAGACACAGGCAGAGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-441s21c1
Sequence:CCGGGATGGTGAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-762s21c1
Sequence:CCGGCCCAGCCTATACCATACCTTTCTCGAGAAAGGTATGGTATAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010708.2-1174s21c1
Sequence:CCGGAGGTCTCTGGCCTAGGGATAACTCGAGTTATCCCTAGGCCAGAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-1016s21c1
Sequence:CCGGGCTTCTCGGTGTGGATCATATCTCGAGATATGATCCACACCGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-1125s21c1
Sequence:CCGGTCTAGAAGTGGCGGGTGATATCTCGAGATATCACCCGCCACTTCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010708.2-849s21c1
Sequence:GTACCGGAGATGCTACGAGGTTCCATATCTCGAGATATGGAACCTCGTAGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010708
VALIDATED
LGALS9 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 9
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-669s1c1
Sequence:CCGGCCCAGCCTATACCATACCTTTCTCGAGAAAGGTATGGTATAGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010708.1-139s1c1
Sequence:CCGGCAAAGGTTTGTGGTGAACTTTCTCGAGAAAGTTCACCACAAACCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010708.1-584s1c1
Sequence:CCGGTGGCTCAAACTACCATCCATACTCGAGTATGGATGGTAGTTTGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-348s1c1
Sequence:CCGGGATGGTGAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010708.1-820s1c1
Sequence:CCGGCGTTTCAATGAGAATGCTGTTCTCGAGAACAGCATTCTCATTGAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010708.2-1202s21c1
Sequence:GTACCGGAGCACTCTGCCTGTGTCTTATCTCGAGATAAGACACAGGCAGAGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-441s21c1
Sequence:CCGGGATGGTGAACAAGAAATTCTTCTCGAGAAGAATTTCTTGTTCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-762s21c1
Sequence:CCGGCCCAGCCTATACCATACCTTTCTCGAGAAAGGTATGGTATAGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010708.2-1174s21c1
Sequence:CCGGAGGTCTCTGGCCTAGGGATAACTCGAGTTATCCCTAGGCCAGAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-1016s21c1
Sequence:CCGGGCTTCTCGGTGTGGATCATATCTCGAGATATGATCCACACCGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010708.2-1125s21c1
Sequence:CCGGTCTAGAAGTGGCGGGTGATATCTCGAGATATCACCCGCCACTTCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010708.2-849s21c1
Sequence:GTACCGGAGATGCTACGAGGTTCCATATCTCGAGATATGGAACCTCGTAGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002308
LGALS9 MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-137s1c1
Sequence:CCGGCGGACTTCAGATCACTGTCAACTCGAGTTGACAGTGATCTGAAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-933s1c1
Sequence:CCGGCACCTGTTTGAATACTACCATCTCGAGATGGTAGTATTCAAACAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-969s1c1
Sequence:CCGGCCCACCATCAACAGACTGGAACTCGAGTTCCAGTCTGTTGATGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-215s1c1
Sequence:CCGGCAGTGGAAATGACATTGCCTTCTCGAGAAGGCAATGTCATTTCCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-635s1c1
Sequence:CCGGGCCTTTCATCACCACCATTCTCTCGAGAGAATGGTGGTGATGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-168s21c1
Sequence:GTACCGGTTTCTGGGACTATTCAAGGAGCTCGAGCTCCTTGAATAGTCCCAGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-936s21c1
Sequence:GTACCGGGCTTCTCAGTGTGGATCTTGTCTCGAGACAAGATCCACACTGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002308.3-1184s21c1
Sequence:GTACCGGGCCTGGGATCTGGGCTTTAATCTCGAGATTAAAGCCCAGATCCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-201s21c1
Sequence:GTACCGGGACTTCAGATCACTGTCAATGCTCGAGCATTGACAGTGATCTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-378s21c1
Sequence:GTACCGGGGAAGACACACATGCCTTTCCCTCGAGGGAAAGGCATGTGTGTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002308.3-1481s21c1
Sequence:GTACCGGCCCTCCTCTCTGACCTTTAACCTCGAGGTTAAAGGTCAGAGAGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-988s21c1
Sequence:GTACCGGTGGTCAGCACCTGTTTGAATACTCGAGTATTCAAACAGGTGCTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002308
LGALS9 MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-137s1c1
Sequence:CCGGCGGACTTCAGATCACTGTCAACTCGAGTTGACAGTGATCTGAAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-933s1c1
Sequence:CCGGCACCTGTTTGAATACTACCATCTCGAGATGGTAGTATTCAAACAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-969s1c1
Sequence:CCGGCCCACCATCAACAGACTGGAACTCGAGTTCCAGTCTGTTGATGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-215s1c1
Sequence:CCGGCAGTGGAAATGACATTGCCTTCTCGAGAAGGCAATGTCATTTCCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-635s1c1
Sequence:CCGGGCCTTTCATCACCACCATTCTCTCGAGAGAATGGTGGTGATGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-168s21c1
Sequence:GTACCGGTTTCTGGGACTATTCAAGGAGCTCGAGCTCCTTGAATAGTCCCAGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-936s21c1
Sequence:GTACCGGGCTTCTCAGTGTGGATCTTGTCTCGAGACAAGATCCACACTGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002308.3-1184s21c1
Sequence:GTACCGGGCCTGGGATCTGGGCTTTAATCTCGAGATTAAAGCCCAGATCCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-201s21c1
Sequence:GTACCGGGACTTCAGATCACTGTCAATGCTCGAGCATTGACAGTGATCTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-378s21c1
Sequence:GTACCGGGGAAGACACACATGCCTTTCCCTCGAGGGAAAGGCATGTGTGTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002308.3-1481s21c1
Sequence:GTACCGGCCCTCCTCTCTGACCTTTAACCTCGAGGTTAAAGGTCAGAGAGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-988s21c1
Sequence:GTACCGGTGGTCAGCACCTGTTTGAATACTCGAGTATTCAAACAGGTGCTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002308
LGALS9 MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-137s1c1
Sequence:CCGGCGGACTTCAGATCACTGTCAACTCGAGTTGACAGTGATCTGAAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-933s1c1
Sequence:CCGGCACCTGTTTGAATACTACCATCTCGAGATGGTAGTATTCAAACAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-969s1c1
Sequence:CCGGCCCACCATCAACAGACTGGAACTCGAGTTCCAGTCTGTTGATGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-215s1c1
Sequence:CCGGCAGTGGAAATGACATTGCCTTCTCGAGAAGGCAATGTCATTTCCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002308.2-635s1c1
Sequence:CCGGGCCTTTCATCACCACCATTCTCTCGAGAGAATGGTGGTGATGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-168s21c1
Sequence:GTACCGGTTTCTGGGACTATTCAAGGAGCTCGAGCTCCTTGAATAGTCCCAGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-936s21c1
Sequence:GTACCGGGCTTCTCAGTGTGGATCTTGTCTCGAGACAAGATCCACACTGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381284    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002308.3-1184s21c1
Sequence:GTACCGGGCCTGGGATCTGGGCTTTAATCTCGAGATTAAAGCCCAGATCCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-201s21c1
Sequence:GTACCGGGACTTCAGATCACTGTCAATGCTCGAGCATTGACAGTGATCTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-378s21c1
Sequence:GTACCGGGGAAGACACACATGCCTTTCCCTCGAGGGAAAGGCATGTGTGTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002308.3-1481s21c1
Sequence:GTACCGGCCCTCCTCTCTGACCTTTAACCTCGAGGTTAAAGGTCAGAGAGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002308.3-988s21c1
Sequence:GTACCGGTGGTCAGCACCTGTTTGAATACTCGAGTATTCAAACAGGTGCTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)