EMAIL THIS PAGE TO A FRIEND

LGALS9B

lectin, galactoside-binding, soluble, 9B

5 Gene Product Result for
Species: Human LGALS9B(284194)
UniProtKB ID: Q3B8N2, A6NLF8, A8K2J8
Gene ID:
Human(284194) Summary: This gene was initially thought to represent a pseudogene of galectin 9; however, this transcript has good exon-intron structure and encodes a predicted protein of the same size as and highly similar to galectin 9. This gene is one of two similar loci on chromosome 17p similar to galectin 9 and now thought to be protein-encoding. This gene is the more centromeric gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302003 ANTI-LGALS9B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042685 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042685 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310983 predicted 894
2 SASI_Hs02_00310984 predicted 250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042685
LGALS9B MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 9B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000255371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-374s21c1
Sequence:CCGGCCTGGTGCAGAGCTCAGATTTCTCGAGAAATCTGAGCTCTGCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-493s21c1
Sequence:CCGGCCTACATCAGCTTCCAGAATCCTCGAGGATTCTGGAAGCTGATGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-457s21c1
Sequence:CCGGTGGACACCATCTCCGTCAATGCTCGAGCATTGACGGAGATGGTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-220s21c1
Sequence:CCGGGCTTCAGTGGAAACGACATTGCTCGAGCAATGTCGTTTCCACTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042685
LGALS9B MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 9B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000255371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-374s21c1
Sequence:CCGGCCTGGTGCAGAGCTCAGATTTCTCGAGAAATCTGAGCTCTGCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-493s21c1
Sequence:CCGGCCTACATCAGCTTCCAGAATCCTCGAGGATTCTGGAAGCTGATGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-457s21c1
Sequence:CCGGTGGACACCATCTCCGTCAATGCTCGAGCATTGACGGAGATGGTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-220s21c1
Sequence:CCGGGCTTCAGTGGAAACGACATTGCTCGAGCAATGTCGTTTCCACTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042685
LGALS9B MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 9B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000255371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-374s21c1
Sequence:CCGGCCTGGTGCAGAGCTCAGATTTCTCGAGAAATCTGAGCTCTGCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-493s21c1
Sequence:CCGGCCTACATCAGCTTCCAGAATCCTCGAGGATTCTGGAAGCTGATGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-457s21c1
Sequence:CCGGTGGACACCATCTCCGTCAATGCTCGAGCATTGACGGAGATGGTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042685.1-220s21c1
Sequence:CCGGGCTTCAGTGGAAACGACATTGCTCGAGCAATGTCGTTTCCACTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)