EMAIL THIS PAGE TO A FRIEND

LGALS9C

lectin, galactoside-binding, soluble, 9C

6 Gene Product Result for
Species: Human LGALS9C(654346)
UniProtKB ID: Q6DKI2, B0AZM7
Gene ID:
Human(654346) Summary: This gene was initially thought to represent a pseudogene of galectin 9; however, this transcript has good exon-intron structure and encodes a predicted protein of the same size as and highly similar to galectin 9. This gene is one of two similar loci on chromosome 17p similar to galectin 9 and now thought to be protein-encoding. This gene is the more telomeric gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040078 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148071 MISSION® esiRNA esiRNA human LGALS9C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040078 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062915 predicted 908
2 SASI_Hs01_00062916 predicted 258
3 SASI_Hs01_00062917 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040078
LGALS9C MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding, soluble, 9C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-1077s21c1
Sequence:CCGGACCTGCCCACCATCAACAAACCTCGAGGTTTGTTGATGGTGGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-198s21c1
Sequence:CCGGCCAGGTTTGCTGTGGACTTTCCTCGAGGAAAGTCCACAGCAAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-1039s21c1
Sequence:CCGGTGGTCAGCACGTGTTTGAATACTCGAGTATTCAAACACGTGCTGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-893s21c1
Sequence:CCGGGAGAATGCTGTGGTCCGTAACCTCGAGGTTACGGACCACAGCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040078.2-1365s21c1
Sequence:CCGGAGCTGCTGGAATCCTACAATCCTCGAGGATTGTAGGATTCCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040078
LGALS9C MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding, soluble, 9C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-1077s21c1
Sequence:CCGGACCTGCCCACCATCAACAAACCTCGAGGTTTGTTGATGGTGGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-198s21c1
Sequence:CCGGCCAGGTTTGCTGTGGACTTTCCTCGAGGAAAGTCCACAGCAAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-1039s21c1
Sequence:CCGGTGGTCAGCACGTGTTTGAATACTCGAGTATTCAAACACGTGCTGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-893s21c1
Sequence:CCGGGAGAATGCTGTGGTCCGTAACCTCGAGGTTACGGACCACAGCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040078.2-1365s21c1
Sequence:CCGGAGCTGCTGGAATCCTACAATCCTCGAGGATTGTAGGATTCCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040078
LGALS9C MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding, soluble, 9C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-1077s21c1
Sequence:CCGGACCTGCCCACCATCAACAAACCTCGAGGTTTGTTGATGGTGGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-198s21c1
Sequence:CCGGCCAGGTTTGCTGTGGACTTTCCTCGAGGAAAGTCCACAGCAAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-1039s21c1
Sequence:CCGGTGGTCAGCACGTGTTTGAATACTCGAGTATTCAAACACGTGCTGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040078.2-893s21c1
Sequence:CCGGGAGAATGCTGTGGTCCGTAACCTCGAGGTTACGGACCACAGCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040078.2-1365s21c1
Sequence:CCGGAGCTGCTGGAATCCTACAATCCTCGAGGATTGTAGGATTCCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)