EMAIL THIS PAGE TO A FRIEND

LGALSL

lectin, galactoside-binding-like

68 Gene Product Result for
Synonyms: GRP
UniProtKB ID: Q3ZCW2, B2RBG8, D6W5E8, Q6P5T6, Q9P005
Gene ID:
Mouse(216551) lectin, galactoside binding-like
Rat(360983) lectin, galactoside-binding-like
chicken(421278) lectin, galactoside-binding-like
cow(516629) lectin, galactoside-binding-like
domestic guinea pig(100728412) lectin, galactoside-binding-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014181 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014181 Rosetta Predictions human pricing
NM_001134730 Rosetta Predictions rat pricing
NM_173752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345201 predicted 944
2 SASI_Hs02_00345202 predicted 513
3 SASI_Hs02_00345203 predicted 974
4 SASI_Hs01_00118406 predicted 598
5 SASI_Hs02_00345204 predicted 500
6 SASI_Hs02_00345205 predicted 1028
7 SASI_Hs01_00118409 predicted 814
8 SASI_Hs02_00345206 predicted 982
9 SASI_Hs02_00345207 predicted 636
10 SASI_Hs02_00345208 predicted 1001
11 SASI_Hs01_00118407 predicted 352
12 SASI_Hs01_00118408 predicted 205
13 SASI_Hs01_00118410 predicted 307
14 SASI_Hs01_00118411 predicted 432
15 SASI_Hs01_00118412 predicted 360
16 SASI_Hs01_00118413 predicted 390
17 SASI_Hs01_00118414 predicted 498
18 SASI_Hs01_00118415 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258214 predicted 567
2 SASI_Rn02_00258215 predicted 975
3 SASI_Rn02_00258216 predicted 725
4 SASI_Rn02_00258217 predicted 682
5 SASI_Rn02_00258218 predicted 639
6 SASI_Rn02_00258219 predicted 840
7 SASI_Rn02_00258220 predicted 741
8 SASI_Rn02_00258221 predicted 423
9 SASI_Rn02_00258222 predicted 930
10 SASI_Rn02_00258223 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187796 predicted 503
2 SASI_Mm01_00187797 predicted 752
3 SASI_Mm01_00187798 predicted 344
4 SASI_Mm01_00187799 predicted 382
5 SASI_Mm01_00187800 predicted 479
6 SASI_Mm02_00345396 predicted 833
7 SASI_Mm01_00187802 predicted 671
8 SASI_Mm01_00187803 predicted 682
9 SASI_Mm01_00187804 predicted 492
10 SASI_Mm02_00345397 predicted 831
11 SASI_Mm01_00187801 predicted 382
12 SASI_Mm01_00187805 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173752
LGALSL MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-427s21c1
Sequence:CCGGCAGTCGGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173752.4-1435s21c1
Sequence:CCGGCCTGTGAATTAGCACAGTATTCTCGAGAATACTGTGCTAATTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-384s21c1
Sequence:CCGGGCTGCTCAGAAACTCTTGTATCTCGAGATACAAGAGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-127s21c1
Sequence:CCGGGCCGTGGTGAAACTTGATGATCTCGAGATCATCAAGTTTCACCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-199s21c1
Sequence:CCGGCCACGACTGATAGTTCCATTTCTCGAGAAATGGAACTATCAGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173752.1-1403s1c1
Sequence:CCGGCCTGTGAATTAGCACAGTATTCTCGAGAATACTGTGCTAATTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-170s1c1
Sequence:CCGGCCACGACTGATAGTTCCATTTCTCGAGAAATGGAACTATCAGTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-355s1c1
Sequence:CCGGGCTGCTCAGAAACTCTTGTATCTCGAGATACAAGAGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-98s1c1
Sequence:CCGGGCCGTGGTGAAACTTGATGATCTCGAGATCATCAAGTTTCACCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-398s1c1
Sequence:CCGGCAGTCGGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173752
LGALSL MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-427s21c1
Sequence:CCGGCAGTCGGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173752.4-1435s21c1
Sequence:CCGGCCTGTGAATTAGCACAGTATTCTCGAGAATACTGTGCTAATTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-384s21c1
Sequence:CCGGGCTGCTCAGAAACTCTTGTATCTCGAGATACAAGAGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-127s21c1
Sequence:CCGGGCCGTGGTGAAACTTGATGATCTCGAGATCATCAAGTTTCACCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-199s21c1
Sequence:CCGGCCACGACTGATAGTTCCATTTCTCGAGAAATGGAACTATCAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173752.1-1403s1c1
Sequence:CCGGCCTGTGAATTAGCACAGTATTCTCGAGAATACTGTGCTAATTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-170s1c1
Sequence:CCGGCCACGACTGATAGTTCCATTTCTCGAGAAATGGAACTATCAGTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-355s1c1
Sequence:CCGGGCTGCTCAGAAACTCTTGTATCTCGAGATACAAGAGTTTCTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-98s1c1
Sequence:CCGGGCCGTGGTGAAACTTGATGATCTCGAGATCATCAAGTTTCACCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-398s1c1
Sequence:CCGGCAGTCGGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCCGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173752
LGALSL MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-427s21c1
Sequence:CCGGCAGTCGGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326067    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173752.4-1435s21c1
Sequence:CCGGCCTGTGAATTAGCACAGTATTCTCGAGAATACTGTGCTAATTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-384s21c1
Sequence:CCGGGCTGCTCAGAAACTCTTGTATCTCGAGATACAAGAGTTTCTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-127s21c1
Sequence:CCGGGCCGTGGTGAAACTTGATGATCTCGAGATCATCAAGTTTCACCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173752.4-199s21c1
Sequence:CCGGCCACGACTGATAGTTCCATTTCTCGAGAAATGGAACTATCAGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173752.1-1403s1c1
Sequence:CCGGCCTGTGAATTAGCACAGTATTCTCGAGAATACTGTGCTAATTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-170s1c1
Sequence:CCGGCCACGACTGATAGTTCCATTTCTCGAGAAATGGAACTATCAGTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-355s1c1
Sequence:CCGGGCTGCTCAGAAACTCTTGTATCTCGAGATACAAGAGTTTCTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-98s1c1
Sequence:CCGGGCCGTGGTGAAACTTGATGATCTCGAGATCATCAAGTTTCACCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173752.1-398s1c1
Sequence:CCGGCAGTCGGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCCGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014181
VALIDATED
LGALSL MISSION shRNA Bacterial Glycerol Stock
lectin, galactoside-binding-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014181.2-445s21c1
Sequence:CCGGTGTACTTCCCACGACTGATAGCTCGAGCTATCAGTCGTGGGAAGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-352s1c1
Sequence:CCGGCAGTCAGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-268s1c1
Sequence:CCGGGATGTGGCAATCGAACTCAAACTCGAGTTTGAGTTCGATTGCCACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014181.2-3272s21c1
Sequence:CCGGCGGGTATGTAAGGTGTTATTTCTCGAGAAATAACACCTTACATACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014181.2-392s21c1
Sequence:CCGGACTAGATGATGGCCATTTAAACTCGAGTTTAAATGGCCATCATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014181.2-815s21c1
Sequence:CCGGATCTGCAATTGACACCATAAACTCGAGTTTATGGTGTCAATTGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-474s1c1
Sequence:CCGGCATTCAAACGTTATCTGCAATCTCGAGATTGCAGATAACGTTTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014181
VALIDATED
LGALSL MISSION shRNA shRNA Plasmid DNA
lectin, galactoside-binding-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014181.2-445s21c1
Sequence:CCGGTGTACTTCCCACGACTGATAGCTCGAGCTATCAGTCGTGGGAAGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-352s1c1
Sequence:CCGGCAGTCAGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-268s1c1
Sequence:CCGGGATGTGGCAATCGAACTCAAACTCGAGTTTGAGTTCGATTGCCACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014181.2-3272s21c1
Sequence:CCGGCGGGTATGTAAGGTGTTATTTCTCGAGAAATAACACCTTACATACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014181.2-392s21c1
Sequence:CCGGACTAGATGATGGCCATTTAAACTCGAGTTTAAATGGCCATCATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014181.2-815s21c1
Sequence:CCGGATCTGCAATTGACACCATAAACTCGAGTTTATGGTGTCAATTGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-474s1c1
Sequence:CCGGCATTCAAACGTTATCTGCAATCTCGAGATTGCAGATAACGTTTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014181
VALIDATED
LGALSL MISSION shRNA Lentiviral Transduction Particles
lectin, galactoside-binding-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014181.2-445s21c1
Sequence:CCGGTGTACTTCCCACGACTGATAGCTCGAGCTATCAGTCGTGGGAAGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-352s1c1
Sequence:CCGGCAGTCAGCAATCCCTTACTTTCTCGAGAAAGTAAGGGATTGCTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-268s1c1
Sequence:CCGGGATGTGGCAATCGAACTCAAACTCGAGTTTGAGTTCGATTGCCACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014181.2-3272s21c1
Sequence:CCGGCGGGTATGTAAGGTGTTATTTCTCGAGAAATAACACCTTACATACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014181.2-392s21c1
Sequence:CCGGACTAGATGATGGCCATTTAAACTCGAGTTTAAATGGCCATCATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014181.2-815s21c1
Sequence:CCGGATCTGCAATTGACACCATAAACTCGAGTTTATGGTGTCAATTGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014181.1-474s1c1
Sequence:CCGGCATTCAAACGTTATCTGCAATCTCGAGATTGCAGATAACGTTTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)