EMAIL THIS PAGE TO A FRIEND

LGI1

leucine-rich, glioma inactivated 1

167 Gene Product Result for
Synonyms: ADLTE ADPAEF ADPEAF EPITEMPIN EPT ETL1 IB1099
Gene ID:
Human(9211) Summary: This gene is rearranged as a result of translocations in glioblastoma cell lines. The protein contains a hydrophobic segment representing a putative transmembrane domain with the amino terminus located outside the cell. It also contains leucine-rich repeats with conserved cysteine-rich flanking sequences. This gene is predominantly expressed in neural tissues and its expression is reduced in low grade brain tumors and significantly reduced or absent in malignant gliomas. Mutations in this gene result in autosomal dominant lateral temporal epilepsy. [provided by RefSeq, Jul 2008]
Mouse(56839) leucine-rich repeat LGI family, member 1
Rat(252892) leucine-rich, glioma inactivated 1
sheep(101105294) leucine-rich, glioma inactivated 1
Domestic Rabbit(100344253) leucine-rich, glioma inactivated 1
domestic guinea pig(100726518) leucine-rich, glioma inactivated 1
naked mole-rat(101703526) leucine-rich, glioma inactivated 1
chicken(423802) leucine-rich, glioma inactivated 1
cow(617080) leucine-rich, glioma inactivated 1
domestic cat(101088030) leucine-rich, glioma inactivated 1
dog(477777) leucine-rich, glioma inactivated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4489 Anti-LGI1 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4531 Anti-LGI1 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1406794 Anti-LGI1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5201437 Monoclonal Anti-Lgi1 - Alkaline Phosphatase antibody produced in mouse clone S283-7, purified immunoglobulin rat, human, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201438 Monoclonal Anti-Lgi1 - Apc antibody produced in mouse clone S283-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201429 Monoclonal Anti-Lgi1 - Atto 390 antibody produced in mouse clone S283-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201430 Monoclonal Anti-Lgi1 - Atto 488 antibody produced in mouse clone S283-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201431 Monoclonal Anti-Lgi1 - Atto 565 antibody produced in mouse clone S283-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201432 Monoclonal Anti-Lgi1 - Atto 594 antibody produced in mouse clone S283-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201433 Monoclonal Anti-Lgi1 - Atto 633 antibody produced in mouse clone S283-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201434 Monoclonal Anti-Lgi1 - Atto 655 antibody produced in mouse clone S283-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201435 Monoclonal Anti-Lgi1 - Atto 680 antibody produced in mouse clone S283-7, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201436 Monoclonal Anti-Lgi1 - Atto 700 antibody produced in mouse clone S283-7, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201439 Monoclonal Anti-Lgi1 - Biotin antibody produced in mouse clone S283-7, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201440 Monoclonal Anti-Lgi1 - Fitc antibody produced in mouse clone S283-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201441 Monoclonal Anti-Lgi1 - Hrp antibody produced in mouse clone S283-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201442 Monoclonal Anti-Lgi1 - Pe/Atto 594 antibody produced in mouse clone S283-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201443 Monoclonal Anti-Lgi1 - Percp antibody produced in mouse clone S283-7, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201444 Monoclonal Anti-Lgi1 - Rpe antibody produced in mouse clone S283-7, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201445 Monoclonal Anti-Lgi1 - Streptavidin antibody produced in mouse clone S283-7, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201428 Monoclonal Anti-Lgi1 antibody produced in mouse clone S283-7, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005097 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005097 Rosetta Predictions human pricing
NM_145769 Rosetta Predictions rat pricing
NM_020278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233511 predicted 1909
2 SASI_Hs01_00233512 predicted 1472
3 SASI_Hs01_00233513 predicted 1689
4 SASI_Hs01_00233514 predicted 1584
5 SASI_Hs01_00233518 predicted 1822
6 SASI_Hs01_00233519 predicted 2065
7 SASI_Hs01_00233520 predicted 623
8 SASI_Hs02_00338974 predicted 1206
9 SASI_Hs02_00338975 predicted 1152
10 SASI_Hs02_00338976 predicted 1033
11 SASI_Hs01_00233515 predicted 1859
12 SASI_Hs01_00233516 predicted 906
13 SASI_Hs01_00233517 predicted 1958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078002 predicted 1000
2 SASI_Rn02_00268755 predicted 409
3 SASI_Rn02_00268756 predicted 1027
4 SASI_Rn02_00268757 predicted 498
5 SASI_Rn02_00268758 predicted 519
6 SASI_Rn01_00078005 predicted 1314
7 SASI_Rn02_00268759 predicted 195
8 SASI_Rn02_00268760 predicted 1271
9 SASI_Rn02_00268761 predicted 814
10 SASI_Rn02_00268762 predicted 1197
11 SASI_Rn01_00078000 predicted 1649
12 SASI_Rn01_00078001 predicted 1850
13 SASI_Rn01_00078003 predicted 620
14 SASI_Rn01_00078004 predicted 1677
15 SASI_Rn01_00078006 predicted 1599
16 SASI_Rn01_00078007 predicted 1746
17 SASI_Rn01_00078008 predicted 265
18 SASI_Rn01_00078009 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171401 predicted 1102
2 SASI_Mm01_00171403 predicted 1442
3 SASI_Mm01_00171405 predicted 1734
4 SASI_Mm01_00171406 predicted 1581
5 SASI_Mm01_00171407 predicted 257
6 SASI_Mm01_00171408 predicted 1409
7 SASI_Mm01_00171409 predicted 1124
8 SASI_Mm01_00171410 predicted 1562
9 SASI_Mm02_00325479 predicted 294
10 SASI_Mm02_00325480 predicted 1830
11 SASI_Mm01_00171402 predicted 605
12 SASI_Mm01_00171404 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005097
LGI1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich, glioma inactivated 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-834s1c1
Sequence:CCGGCCAGAATACAAGAAGCGCAAACTCGAGTTTGCGCTTCTTGTATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-1069s1c1
Sequence:CCGGCCACTGTAGTATGCAAGCCTACTCGAGTAGGCTTGCATACTACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-1411s1c1
Sequence:CCGGCGCCTCATTTAATTCTGTCTACTCGAGTAGACAGAATTAAATGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-920s1c1
Sequence:CCGGGCCTTATCAATCATTGTCCATCTCGAGATGGACAATGATTGATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-506s1c1
Sequence:CCGGGCTCTTGTTATTCACATCGAACTCGAGTTCGATGTGAATAACAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-525s21c1
Sequence:CCGGCACCGTTCCTCCTGATGTTATCTCGAGATAACATCAGGAGGAACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-1920s21c1
Sequence:CCGGGTCCATTAATAAGCGTAATTTCTCGAGAAATTACGCTTATTAATGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-972s21c1
Sequence:CCGGTAGTCTCTCCTCGAAGGATTTCTCGAGAAATCCTTCGAGGAGAGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005097
LGI1 MISSION shRNA shRNA Plasmid DNA
leucine-rich, glioma inactivated 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-834s1c1
Sequence:CCGGCCAGAATACAAGAAGCGCAAACTCGAGTTTGCGCTTCTTGTATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-1069s1c1
Sequence:CCGGCCACTGTAGTATGCAAGCCTACTCGAGTAGGCTTGCATACTACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-1411s1c1
Sequence:CCGGCGCCTCATTTAATTCTGTCTACTCGAGTAGACAGAATTAAATGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-920s1c1
Sequence:CCGGGCCTTATCAATCATTGTCCATCTCGAGATGGACAATGATTGATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-506s1c1
Sequence:CCGGGCTCTTGTTATTCACATCGAACTCGAGTTCGATGTGAATAACAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-525s21c1
Sequence:CCGGCACCGTTCCTCCTGATGTTATCTCGAGATAACATCAGGAGGAACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-1920s21c1
Sequence:CCGGGTCCATTAATAAGCGTAATTTCTCGAGAAATTACGCTTATTAATGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-972s21c1
Sequence:CCGGTAGTCTCTCCTCGAAGGATTTCTCGAGAAATCCTTCGAGGAGAGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005097
LGI1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich, glioma inactivated 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-834s1c1
Sequence:CCGGCCAGAATACAAGAAGCGCAAACTCGAGTTTGCGCTTCTTGTATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-1069s1c1
Sequence:CCGGCCACTGTAGTATGCAAGCCTACTCGAGTAGGCTTGCATACTACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-1411s1c1
Sequence:CCGGCGCCTCATTTAATTCTGTCTACTCGAGTAGACAGAATTAAATGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-920s1c1
Sequence:CCGGGCCTTATCAATCATTGTCCATCTCGAGATGGACAATGATTGATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005097.1-506s1c1
Sequence:CCGGGCTCTTGTTATTCACATCGAACTCGAGTTCGATGTGAATAACAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-525s21c1
Sequence:CCGGCACCGTTCCTCCTGATGTTATCTCGAGATAACATCAGGAGGAACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-1920s21c1
Sequence:CCGGGTCCATTAATAAGCGTAATTTCTCGAGAAATTACGCTTATTAATGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005097.2-972s21c1
Sequence:CCGGTAGTCTCTCCTCGAAGGATTTCTCGAGAAATCCTTCGAGGAGAGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020278
LGI1 MISSION shRNA Bacterial Glycerol Stock
leucine-rich, glioma inactivated 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-620s1c1
Sequence:CCGGCGCATTTAATTGTGACTGTAACTCGAGTTACAGTCACAATTAAATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-1447s1c1
Sequence:CCGGCCAGATTCATTGGCGACTCTACTCGAGTAGAGTCGCCAATGAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-1280s1c1
Sequence:CCGGCCTCAGAACACCTCATTTAATCTCGAGATTAAATGAGGTGTTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-383s1c1
Sequence:CCGGGCTCTTGTTATTTACGTCGAACTCGAGTTCGACGTAAATAACAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020278.2-1997s1c1
Sequence:CCGGGCAGTGAAGATGTGTAAATAACTCGAGTTATTTACACATCTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-906s1c1
Sequence:CCGGGAGAAGACCTTCCGGAATTATCTCGAGATAATTCCGGAAGGTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-244s1c1
Sequence:CCGGGTAGCAAAGATAACGCTTTATCTCGAGATAAAGCGTTATCTTTGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020278
LGI1 MISSION shRNA shRNA Plasmid DNA
leucine-rich, glioma inactivated 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-620s1c1
Sequence:CCGGCGCATTTAATTGTGACTGTAACTCGAGTTACAGTCACAATTAAATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-1447s1c1
Sequence:CCGGCCAGATTCATTGGCGACTCTACTCGAGTAGAGTCGCCAATGAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-1280s1c1
Sequence:CCGGCCTCAGAACACCTCATTTAATCTCGAGATTAAATGAGGTGTTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-383s1c1
Sequence:CCGGGCTCTTGTTATTTACGTCGAACTCGAGTTCGACGTAAATAACAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020278.2-1997s1c1
Sequence:CCGGGCAGTGAAGATGTGTAAATAACTCGAGTTATTTACACATCTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-906s1c1
Sequence:CCGGGAGAAGACCTTCCGGAATTATCTCGAGATAATTCCGGAAGGTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-244s1c1
Sequence:CCGGGTAGCAAAGATAACGCTTTATCTCGAGATAAAGCGTTATCTTTGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020278
LGI1 MISSION shRNA Lentiviral Transduction Particles
leucine-rich, glioma inactivated 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-620s1c1
Sequence:CCGGCGCATTTAATTGTGACTGTAACTCGAGTTACAGTCACAATTAAATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-1447s1c1
Sequence:CCGGCCAGATTCATTGGCGACTCTACTCGAGTAGAGTCGCCAATGAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-1280s1c1
Sequence:CCGGCCTCAGAACACCTCATTTAATCTCGAGATTAAATGAGGTGTTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-383s1c1
Sequence:CCGGGCTCTTGTTATTTACGTCGAACTCGAGTTCGACGTAAATAACAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020278.2-1997s1c1
Sequence:CCGGGCAGTGAAGATGTGTAAATAACTCGAGTTATTTACACATCTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-906s1c1
Sequence:CCGGGAGAAGACCTTCCGGAATTATCTCGAGATAATTCCGGAAGGTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020278.2-244s1c1
Sequence:CCGGGTAGCAAAGATAACGCTTTATCTCGAGATAAAGCGTTATCTTTGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)