EMAIL THIS PAGE TO A FRIEND

LGI2

leucine-rich repeat LGI family, member 2

100 Gene Product Result for
Synonyms: LGIL2
UniProtKB ID: Q8N0V4, Q3MIN2, Q8NDW6, Q96PX2, Q9NVK4
Gene ID:
Mouse(246316) leucine-rich repeat LGI family, member 2
Rat(305417) leucine-rich repeat LGI family, member 2
chicken(422809) leucine-rich repeat LGI family, member 2
domestic cat(101082903) leucine-rich repeat LGI family, member 2
cow(541046) leucine-rich repeat LGI family, member 2
Horse(100067566) leucine-rich repeat LGI family, member 2
dog(488853) leucine-rich repeat LGI family, member 2
domestic guinea pig(100720962) leucine-rich repeat LGI family, member 2
naked mole-rat(101701615) leucine-rich repeat LGI family, member 2
sheep(101104997) leucine-rich repeat LGI family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018176 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018176 Rosetta Predictions human pricing
NM_001107219 Rosetta Predictions rat pricing
NM_144945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182523 predicted 1263
2 SASI_Hs01_00182525 predicted 630
3 SASI_Hs01_00182526 predicted 1440
4 SASI_Hs01_00182527 predicted 523
5 SASI_Hs01_00182528 predicted 928
6 SASI_Hs01_00182529 predicted 1435
7 SASI_Hs01_00182530 predicted 400
8 SASI_Hs01_00182531 predicted 624
9 SASI_Hs01_00182532 predicted 972
10 SASI_Hs02_00351429 predicted 548
11 SASI_Hs01_00182524 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226685 predicted 1455
2 SASI_Rn02_00226686 predicted 798
3 SASI_Rn02_00226687 predicted 1273
4 SASI_Rn02_00226688 predicted 446
5 SASI_Rn02_00226689 predicted 595
6 SASI_Rn02_00226690 predicted 1023
7 SASI_Rn02_00226691 predicted 818
8 SASI_Rn02_00226692 predicted 651
9 SASI_Rn02_00226693 predicted 986
10 SASI_Rn02_00226694 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178845 predicted 1171
2 SASI_Mm01_00178846 predicted 1628
3 SASI_Mm01_00178847 predicted 976
4 SASI_Mm01_00178850 predicted 1034
5 SASI_Mm01_00178851 predicted 664
6 SASI_Mm01_00178852 predicted 1580
7 SASI_Mm01_00178853 predicted 599
8 SASI_Mm01_00178854 predicted 1450
9 SASI_Mm02_00340467 predicted 986
10 SASI_Mm02_00340468 predicted 705
11 SASI_Mm01_00178848 predicted 897
12 SASI_Mm01_00178849 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018176
LGI2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat LGI family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018176.3-1050s21c1
Sequence:CCGGCATAGAGGTCTCTCGCATTTCCTCGAGGAAATGCGAGAGACCTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-469s1c1
Sequence:CCGGGACTCTCTGATTGAACTAGATCTCGAGATCTAGTTCAATCAGAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-1042s1c1
Sequence:CCGGGCTGGTCTGTCCACAGTTTATCTCGAGATAAACTGTGGACAGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018176.2-2166s1c1
Sequence:CCGGCCTCCTTAATAGCAGAACCTTCTCGAGAAGGTTCTGCTATTAAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-787s1c1
Sequence:CCGGGAAATGAATTTCCGGAGCTATCTCGAGATAGCTCCGGAAATTCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-1005s1c1
Sequence:CCGGCGACGAGACGTTCTTTGTCATCTCGAGATGACAAAGAACGTCTCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-120s1c1
Sequence:CCGGCAGCTGTACCAAGGAGTCTATCTCGAGATAGACTCCTTGGTACAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-563s1c1
Sequence:CCGGCCGTTTCTGATGTGCTGTGTACTCGAGTACACAGCACATCAGAAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018176.3-1926s21c1
Sequence:CCGCACATGCCCATTCTACCATTTACTCGAGTAAATGGTAGAATGGGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018176
LGI2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat LGI family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018176.3-1050s21c1
Sequence:CCGGCATAGAGGTCTCTCGCATTTCCTCGAGGAAATGCGAGAGACCTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-469s1c1
Sequence:CCGGGACTCTCTGATTGAACTAGATCTCGAGATCTAGTTCAATCAGAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-1042s1c1
Sequence:CCGGGCTGGTCTGTCCACAGTTTATCTCGAGATAAACTGTGGACAGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018176.2-2166s1c1
Sequence:CCGGCCTCCTTAATAGCAGAACCTTCTCGAGAAGGTTCTGCTATTAAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-787s1c1
Sequence:CCGGGAAATGAATTTCCGGAGCTATCTCGAGATAGCTCCGGAAATTCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-1005s1c1
Sequence:CCGGCGACGAGACGTTCTTTGTCATCTCGAGATGACAAAGAACGTCTCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-120s1c1
Sequence:CCGGCAGCTGTACCAAGGAGTCTATCTCGAGATAGACTCCTTGGTACAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-563s1c1
Sequence:CCGGCCGTTTCTGATGTGCTGTGTACTCGAGTACACAGCACATCAGAAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018176.3-1926s21c1
Sequence:CCGCACATGCCCATTCTACCATTTACTCGAGTAAATGGTAGAATGGGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018176
LGI2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat LGI family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018176.3-1050s21c1
Sequence:CCGGCATAGAGGTCTCTCGCATTTCCTCGAGGAAATGCGAGAGACCTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-469s1c1
Sequence:CCGGGACTCTCTGATTGAACTAGATCTCGAGATCTAGTTCAATCAGAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-1042s1c1
Sequence:CCGGGCTGGTCTGTCCACAGTTTATCTCGAGATAAACTGTGGACAGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018176.2-2166s1c1
Sequence:CCGGCCTCCTTAATAGCAGAACCTTCTCGAGAAGGTTCTGCTATTAAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-787s1c1
Sequence:CCGGGAAATGAATTTCCGGAGCTATCTCGAGATAGCTCCGGAAATTCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-1005s1c1
Sequence:CCGGCGACGAGACGTTCTTTGTCATCTCGAGATGACAAAGAACGTCTCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-120s1c1
Sequence:CCGGCAGCTGTACCAAGGAGTCTATCTCGAGATAGACTCCTTGGTACAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018176.2-563s1c1
Sequence:CCGGCCGTTTCTGATGTGCTGTGTACTCGAGTACACAGCACATCAGAAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018176.3-1926s21c1
Sequence:CCGCACATGCCCATTCTACCATTTACTCGAGTAAATGGTAGAATGGGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144945
LGI2 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat LGI family, member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1111s1c1
Sequence:CCGGGAGCTGGACCAAGTTTGTCAACTCGAGTTGACAAACTTGGTCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-723s1c1
Sequence:CCGGGCTTTGACTATGAGTGTACCACTCGAGTGGTACACTCATAGTCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1529s1c1
Sequence:CCGGCGTTGGAACAGTAAGCAGTTTCTCGAGAAACTGCTTACTGTTCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.2-977s1c1
Sequence:CCGGGAAATGAATTTCCGGAGTTATCTCGAGATAACTCCGGAAATTCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-360s1c1
Sequence:CCGGCCCTGAGCCTAGTAAATGGAACTCGAGTTCCATTTACTAGGCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1528s1c1
Sequence:CCGGGCGTTGGAACAGTAAGCAGTTCTCGAGAACTGCTTACTGTTCCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-720s1c1
Sequence:CCGGCCAGCTTTGACTATGAGTGTACTCGAGTACACTCATAGTCAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-505s1c1
Sequence:CCGGCCTGTTCATTGAAGGGAACAACTCGAGTTGTTCCCTTCAATGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1282s1c1
Sequence:CCGGCCAGTCACTACATGAGTGGTTCTCGAGAACCACTCATGTAGTGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144945
LGI2 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat LGI family, member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1111s1c1
Sequence:CCGGGAGCTGGACCAAGTTTGTCAACTCGAGTTGACAAACTTGGTCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-723s1c1
Sequence:CCGGGCTTTGACTATGAGTGTACCACTCGAGTGGTACACTCATAGTCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1529s1c1
Sequence:CCGGCGTTGGAACAGTAAGCAGTTTCTCGAGAAACTGCTTACTGTTCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.2-977s1c1
Sequence:CCGGGAAATGAATTTCCGGAGTTATCTCGAGATAACTCCGGAAATTCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-360s1c1
Sequence:CCGGCCCTGAGCCTAGTAAATGGAACTCGAGTTCCATTTACTAGGCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1528s1c1
Sequence:CCGGGCGTTGGAACAGTAAGCAGTTCTCGAGAACTGCTTACTGTTCCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-720s1c1
Sequence:CCGGCCAGCTTTGACTATGAGTGTACTCGAGTACACTCATAGTCAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-505s1c1
Sequence:CCGGCCTGTTCATTGAAGGGAACAACTCGAGTTGTTCCCTTCAATGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1282s1c1
Sequence:CCGGCCAGTCACTACATGAGTGGTTCTCGAGAACCACTCATGTAGTGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144945
LGI2 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat LGI family, member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1111s1c1
Sequence:CCGGGAGCTGGACCAAGTTTGTCAACTCGAGTTGACAAACTTGGTCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-723s1c1
Sequence:CCGGGCTTTGACTATGAGTGTACCACTCGAGTGGTACACTCATAGTCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1529s1c1
Sequence:CCGGCGTTGGAACAGTAAGCAGTTTCTCGAGAAACTGCTTACTGTTCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.2-977s1c1
Sequence:CCGGGAAATGAATTTCCGGAGTTATCTCGAGATAACTCCGGAAATTCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-360s1c1
Sequence:CCGGCCCTGAGCCTAGTAAATGGAACTCGAGTTCCATTTACTAGGCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1528s1c1
Sequence:CCGGGCGTTGGAACAGTAAGCAGTTCTCGAGAACTGCTTACTGTTCCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-720s1c1
Sequence:CCGGCCAGCTTTGACTATGAGTGTACTCGAGTACACTCATAGTCAAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-505s1c1
Sequence:CCGGCCTGTTCATTGAAGGGAACAACTCGAGTTGTTCCCTTCAATGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144945.1-1282s1c1
Sequence:CCGGCCAGTCACTACATGAGTGGTTCTCGAGAACCACTCATGTAGTGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)