EMAIL THIS PAGE TO A FRIEND

LGI3

leucine-rich repeat LGI family, member 3

52 Gene Product Result for
Synonyms: LGIL4
UniProtKB ID: Q8N145, Q86TL4, Q8N296
Gene ID:
Mouse(213469) leucine-rich repeat LGI family, member 3
Rat(306013) leucine-rich repeat LGI family, member 3
Zebrafish(654830) leucine-rich repeat LGI family, member 3
domestic cat(101089853) leucine-rich repeat LGI family, member 3
cow(516661) leucine-rich repeat LGI family, member 3
Horse(100056797) leucine-rich repeat LGI family, member 3
dog(486128) leucine-rich repeat LGI family, member 3
sheep(101122581) leucine-rich repeat LGI family, member 3
domestic guinea pig(100728483) leucine-rich repeat LGI family, member 3
naked mole-rat(101711898) leucine-rich repeat LGI family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139278 Rosetta Predictions human pricing
NM_001107277 Rosetta Predictions rat pricing
NM_145219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364257 predicted 791
2 SASI_Hs01_00019622 predicted 1757
3 SASI_Hs01_00019623 predicted 1775
4 SASI_Hs01_00019624 predicted 646
5 SASI_Hs01_00019625 predicted 1899
6 SASI_Hs01_00019626 predicted 1183
7 SASI_Hs01_00019627 predicted 1090
8 SASI_Hs01_00019628 predicted 1353
9 SASI_Hs01_00019629 predicted 1072
10 SASI_Hs01_00019630 predicted 1998
11 SASI_Hs01_00019631 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107277 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227255 predicted 1695
2 SASI_Rn02_00227256 predicted 1700
3 SASI_Rn02_00227257 predicted 882
4 SASI_Rn02_00227258 predicted 1867
5 SASI_Rn02_00227259 predicted 1994
6 SASI_Rn02_00227260 predicted 1830
7 SASI_Rn02_00227261 predicted 1020
8 SASI_Rn02_00227262 predicted 671
9 SASI_Rn02_00227263 predicted 401
10 SASI_Rn02_00227264 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153398 predicted 1815
2 SASI_Mm02_00340595 predicted 1782
3 SASI_Mm01_00153399 predicted 701
4 SASI_Mm01_00153400 predicted 1813
5 SASI_Mm01_00153401 predicted 1690
6 SASI_Mm01_00153402 predicted 455
7 SASI_Mm01_00153403 predicted 475
8 SASI_Mm01_00153404 predicted 833
9 SASI_Mm01_00153405 predicted 556
10 SASI_Mm01_00153407 predicted 897
11 SASI_Mm01_00153406 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139278
LGI3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat LGI family, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1097s1c1
Sequence:CCGGCGAGACTATGATAGAATCCCACTCGAGTGGGATTCTATCATAGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1093s1c1
Sequence:CCGGGCTTCGAGACTATGATAGAATCTCGAGATTCTATCATAGTCTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-763s1c1
Sequence:CCGGCCTGGACATCCTGAATGACTTCTCGAGAAGTCATTCAGGATGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1556s1c1
Sequence:CCGGGCCCAAGCTGTGAAACACTTTCTCGAGAAAGTGTTTCACAGCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139278.2-2323s21c1
Sequence:CCGGGGTGCTCCAGGCATTGTTTACCTCGAGGTAAACAATGCCTGGAGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-622s21c1
Sequence:CCGGGTCGCACCTGCAGTATCTCTTCTCGAGAAGAGATACTGCAGGTGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-1186s21c1
Sequence:CCGGGTTTGGCGGCTCTTACATTTACTCGAGTAAATGTAAGAGCCGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-652s21c1
Sequence:CCGGCAATGACATCTGGGCACTATCCTCGAGGATAGTGCCCAGATGTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139278
LGI3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat LGI family, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1097s1c1
Sequence:CCGGCGAGACTATGATAGAATCCCACTCGAGTGGGATTCTATCATAGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1093s1c1
Sequence:CCGGGCTTCGAGACTATGATAGAATCTCGAGATTCTATCATAGTCTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-763s1c1
Sequence:CCGGCCTGGACATCCTGAATGACTTCTCGAGAAGTCATTCAGGATGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1556s1c1
Sequence:CCGGGCCCAAGCTGTGAAACACTTTCTCGAGAAAGTGTTTCACAGCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139278.2-2323s21c1
Sequence:CCGGGGTGCTCCAGGCATTGTTTACCTCGAGGTAAACAATGCCTGGAGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-622s21c1
Sequence:CCGGGTCGCACCTGCAGTATCTCTTCTCGAGAAGAGATACTGCAGGTGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-1186s21c1
Sequence:CCGGGTTTGGCGGCTCTTACATTTACTCGAGTAAATGTAAGAGCCGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-652s21c1
Sequence:CCGGCAATGACATCTGGGCACTATCCTCGAGGATAGTGCCCAGATGTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139278
LGI3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat LGI family, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1097s1c1
Sequence:CCGGCGAGACTATGATAGAATCCCACTCGAGTGGGATTCTATCATAGTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1093s1c1
Sequence:CCGGGCTTCGAGACTATGATAGAATCTCGAGATTCTATCATAGTCTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-763s1c1
Sequence:CCGGCCTGGACATCCTGAATGACTTCTCGAGAAGTCATTCAGGATGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139278.2-1556s1c1
Sequence:CCGGGCCCAAGCTGTGAAACACTTTCTCGAGAAAGTGTTTCACAGCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139278.2-2323s21c1
Sequence:CCGGGGTGCTCCAGGCATTGTTTACCTCGAGGTAAACAATGCCTGGAGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-622s21c1
Sequence:CCGGGTCGCACCTGCAGTATCTCTTCTCGAGAAGAGATACTGCAGGTGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-1186s21c1
Sequence:CCGGGTTTGGCGGCTCTTACATTTACTCGAGTAAATGTAAGAGCCGCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139278.2-652s21c1
Sequence:CCGGCAATGACATCTGGGCACTATCCTCGAGGATAGTGCCCAGATGTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145219
LGI3 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat LGI family, member 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145219.2-2017s1c1
Sequence:CCGGCCATTCCCATTACTGTAATAACTCGAGTTATTACAGTAATGGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145219.2-1408s1c1
Sequence:CCGGGAGTCGTTCTCAGAAACAGTTCTCGAGAACTGTTTCTGAGAACGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145219.2-1000s1c1
Sequence:CCGGGCTTCGAGACTATGACAGAATCTCGAGATTCTGTCATAGTCTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145219.2-844s1c1
Sequence:CCGGCGACTGCATCACCACTGATTTCTCGAGAAATCAGTGGTGATGCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145219.2-898s1c1
Sequence:CCGGGTCTGCGGAACCTTTCCTTTACTCGAGTAAAGGAAAGGTTCCGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145219.2-2588s1c1
Sequence:CCGGGCCACTTCATCCAGAAGCAATCTCGAGATTGCTTCTGGATGAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145219
LGI3 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat LGI family, member 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145219.2-2017s1c1
Sequence:CCGGCCATTCCCATTACTGTAATAACTCGAGTTATTACAGTAATGGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145219.2-1408s1c1
Sequence:CCGGGAGTCGTTCTCAGAAACAGTTCTCGAGAACTGTTTCTGAGAACGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145219.2-1000s1c1
Sequence:CCGGGCTTCGAGACTATGACAGAATCTCGAGATTCTGTCATAGTCTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145219.2-844s1c1
Sequence:CCGGCGACTGCATCACCACTGATTTCTCGAGAAATCAGTGGTGATGCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145219.2-898s1c1
Sequence:CCGGGTCTGCGGAACCTTTCCTTTACTCGAGTAAAGGAAAGGTTCCGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145219.2-2588s1c1
Sequence:CCGGGCCACTTCATCCAGAAGCAATCTCGAGATTGCTTCTGGATGAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145219
LGI3 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat LGI family, member 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145219.2-2017s1c1
Sequence:CCGGCCATTCCCATTACTGTAATAACTCGAGTTATTACAGTAATGGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145219.2-1408s1c1
Sequence:CCGGGAGTCGTTCTCAGAAACAGTTCTCGAGAACTGTTTCTGAGAACGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145219.2-1000s1c1
Sequence:CCGGGCTTCGAGACTATGACAGAATCTCGAGATTCTGTCATAGTCTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145219.2-844s1c1
Sequence:CCGGCGACTGCATCACCACTGATTTCTCGAGAAATCAGTGGTGATGCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145219.2-898s1c1
Sequence:CCGGGTCTGCGGAACCTTTCCTTTACTCGAGTAAAGGAAAGGTTCCGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184334    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145219.2-2588s1c1
Sequence:CCGGGCCACTTCATCCAGAAGCAATCTCGAGATTGCTTCTGGATGAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)