EMAIL THIS PAGE TO A FRIEND

LGI4

leucine-rich repeat LGI family, member 4

87 Gene Product Result for
Synonyms: LGIL3
UniProtKB ID: Q8N135, B2RN53, B9EGS7, Q5M8T1
Gene ID:
Mouse(243914) leucine-rich repeat LGI family, member 4
Rat(361549) leucine-rich repeat LGI family, member 4
domestic guinea pig(100719310) leucine-rich repeat LGI family, member 4
naked mole-rat(101704150) leucine-rich repeat LGI family, member 4
sheep(101118631) leucine-rich repeat LGI family, member 4
Domestic Rabbit(100345638) leucine-rich repeat LGI family, member 4
cow(618195) leucine-rich repeat LGI family, member 4
Horse(100050571) leucine-rich repeat LGI family, member 4
domestic cat(101080343) leucine-rich repeat LGI family, member 4
dog(484582) leucine-rich repeat LGI family, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144556 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144556 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144556 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006551 MISSION® esiRNA esiRNA targeting human LGI4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139284 Rosetta Predictions human pricing
NM_199499 Rosetta Predictions rat pricing
NM_144556 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199634 predicted 1776
2 SASI_Hs01_00199635 predicted 2300
3 SASI_Hs02_00364273 predicted 1497
4 SASI_Hs01_00199637 predicted 2249
5 SASI_Hs01_00199639 predicted 1902
6 SASI_Hs01_00199640 predicted 1138
7 SASI_Hs01_00199641 predicted 778
8 SASI_Hs01_00199642 predicted 1184
9 SASI_Hs01_00199643 predicted 2217
10 SASI_Hs02_00364274 predicted 2440
11 SASI_Hs01_00199636 predicted 1249
12 SASI_Hs01_00199638 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069863 predicted 806
2 SASI_Rn01_00069865 predicted 1954
3 SASI_Rn01_00069866 predicted 700
4 SASI_Rn01_00069868 predicted 1042
5 SASI_Rn01_00069869 predicted 462
6 SASI_Rn02_00270271 predicted 470
7 SASI_Rn01_00069870 predicted 816
8 SASI_Rn01_00069871 predicted 596
9 SASI_Rn02_00270272 predicted 791
10 SASI_Rn02_00270273 predicted 1387
11 SASI_Rn01_00069864 predicted 448
12 SASI_Rn01_00069867 predicted 1655
13 SASI_Rn01_00069872 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125204 predicted 572
2 SASI_Mm01_00125205 predicted 681
3 SASI_Mm01_00125206 predicted 314
4 SASI_Mm01_00125207 predicted 1675
5 SASI_Mm01_00125208 predicted 339
6 SASI_Mm01_00125209 predicted 1530
7 SASI_Mm01_00125210 predicted 1028
8 SASI_Mm02_00340101 predicted 1600
9 SASI_Mm01_00125212 predicted 691
10 SASI_Mm01_00125213 predicted 669
11 SASI_Mm01_00125211 predicted 1668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139284
LGI4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat LGI family, member 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-2138s21c1
Sequence:CCGGTCCTCTTTGCTGCTTGCTTTACTCGAGTAAAGCAAGCAGCAAAGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-976s21c1
Sequence:CCGGCACCTAAGCCTGGCCAATAACCTCGAGGTTATTGGCCAGGCTTAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-1862s21c1
Sequence:CCGGTGTGCCTCACACGCTACATTGCTCGAGCAATGTAGCGTGTGAGGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-905s21c1
Sequence:CCGGACCTCTTCATCGAGGACAATGCTCGAGCATTGTCCTCGATGAAGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-786s1c1
Sequence:CCGGCGTGATTGAGGACGATGCATTCTCGAGAATGCATCGTCCTCAATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-787s1c1
Sequence:CCGGGTGATTGAGGACGATGCATTTCTCGAGAAATGCATCGTCCTCAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139284.1-2344s1c1
Sequence:CCGGCCTTCAGGTCTAAAGCAACATCTCGAGATGTTGCTTTAGACCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139284.1-2274s1c1
Sequence:CCGGCCACTTCTTAAAGGATCTGCACTCGAGTGCAGATCCTTTAAGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-2097s1c1
Sequence:CCGGGATCTACCAGCATCACGAGATCTCGAGATCTCGTGATGCTGGTAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-1125s1c1
Sequence:CCGGGACTTTCAAGTGCAGAGCCATCTCGAGATGGCTCTGCACTTGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-1120s1c1
Sequence:CCGGCCCAAGACTTTCAAGTGCAGACTCGAGTCTGCACTTGAAAGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-774s1c1
Sequence:CCGGCAACTCCTTCTCCGTGATTGACTCGAGTCAATCACGGAGAAGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139284
LGI4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat LGI family, member 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-2138s21c1
Sequence:CCGGTCCTCTTTGCTGCTTGCTTTACTCGAGTAAAGCAAGCAGCAAAGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-976s21c1
Sequence:CCGGCACCTAAGCCTGGCCAATAACCTCGAGGTTATTGGCCAGGCTTAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-1862s21c1
Sequence:CCGGTGTGCCTCACACGCTACATTGCTCGAGCAATGTAGCGTGTGAGGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-905s21c1
Sequence:CCGGACCTCTTCATCGAGGACAATGCTCGAGCATTGTCCTCGATGAAGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-786s1c1
Sequence:CCGGCGTGATTGAGGACGATGCATTCTCGAGAATGCATCGTCCTCAATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-787s1c1
Sequence:CCGGGTGATTGAGGACGATGCATTTCTCGAGAAATGCATCGTCCTCAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139284.1-2344s1c1
Sequence:CCGGCCTTCAGGTCTAAAGCAACATCTCGAGATGTTGCTTTAGACCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139284.1-2274s1c1
Sequence:CCGGCCACTTCTTAAAGGATCTGCACTCGAGTGCAGATCCTTTAAGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-2097s1c1
Sequence:CCGGGATCTACCAGCATCACGAGATCTCGAGATCTCGTGATGCTGGTAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-1125s1c1
Sequence:CCGGGACTTTCAAGTGCAGAGCCATCTCGAGATGGCTCTGCACTTGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-1120s1c1
Sequence:CCGGCCCAAGACTTTCAAGTGCAGACTCGAGTCTGCACTTGAAAGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-774s1c1
Sequence:CCGGCAACTCCTTCTCCGTGATTGACTCGAGTCAATCACGGAGAAGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139284
LGI4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat LGI family, member 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-2138s21c1
Sequence:CCGGTCCTCTTTGCTGCTTGCTTTACTCGAGTAAAGCAAGCAGCAAAGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-976s21c1
Sequence:CCGGCACCTAAGCCTGGCCAATAACCTCGAGGTTATTGGCCAGGCTTAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-1862s21c1
Sequence:CCGGTGTGCCTCACACGCTACATTGCTCGAGCAATGTAGCGTGTGAGGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139284.2-905s21c1
Sequence:CCGGACCTCTTCATCGAGGACAATGCTCGAGCATTGTCCTCGATGAAGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-786s1c1
Sequence:CCGGCGTGATTGAGGACGATGCATTCTCGAGAATGCATCGTCCTCAATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-787s1c1
Sequence:CCGGGTGATTGAGGACGATGCATTTCTCGAGAAATGCATCGTCCTCAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139284.1-2344s1c1
Sequence:CCGGCCTTCAGGTCTAAAGCAACATCTCGAGATGTTGCTTTAGACCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139284.1-2274s1c1
Sequence:CCGGCCACTTCTTAAAGGATCTGCACTCGAGTGCAGATCCTTTAAGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-2097s1c1
Sequence:CCGGGATCTACCAGCATCACGAGATCTCGAGATCTCGTGATGCTGGTAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139284.1-1125s1c1
Sequence:CCGGGACTTTCAAGTGCAGAGCCATCTCGAGATGGCTCTGCACTTGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-1120s1c1
Sequence:CCGGCCCAAGACTTTCAAGTGCAGACTCGAGTCTGCACTTGAAAGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139284.1-774s1c1
Sequence:CCGGCAACTCCTTCTCCGTGATTGACTCGAGTCAATCACGGAGAAGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144556
LGI4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat LGI family, member 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144556.2-2100s1c1
Sequence:CCGGGAGCATTCCTTTCCACTTAAACTCGAGTTTAAGTGGAAAGGAATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-1449s1c1
Sequence:CCGGGTCTTCCAGCCACTACTAATTCTCGAGAATTAGTAGTGGCTGGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-681s1c1
Sequence:CCGGCTTGACCCTAAGAAGTTCAAGCTCGAGCTTGAACTTCTTAGGGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-1520s1c1
Sequence:CCGGCTTCCGCTTTGAGTCCGATAACTCGAGTTATCGGACTCAAAGCGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144556.2-1790s1c1
Sequence:CCGGCCTGTGTGATACAGACCACTACTCGAGTAGTGGTCTGTATCACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144556.2-329s1c1
Sequence:CCGGCCTCTTCACATCCAATACCTTCTCGAGAAGGTATTGGATGTGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144556.2-298s1c1
Sequence:CCGGGCTTCTTAAAGATGCCGTCATCTCGAGATGACGGCATCTTTAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144556
LGI4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat LGI family, member 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144556.2-2100s1c1
Sequence:CCGGGAGCATTCCTTTCCACTTAAACTCGAGTTTAAGTGGAAAGGAATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-1449s1c1
Sequence:CCGGGTCTTCCAGCCACTACTAATTCTCGAGAATTAGTAGTGGCTGGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-681s1c1
Sequence:CCGGCTTGACCCTAAGAAGTTCAAGCTCGAGCTTGAACTTCTTAGGGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-1520s1c1
Sequence:CCGGCTTCCGCTTTGAGTCCGATAACTCGAGTTATCGGACTCAAAGCGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144556.2-1790s1c1
Sequence:CCGGCCTGTGTGATACAGACCACTACTCGAGTAGTGGTCTGTATCACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144556.2-329s1c1
Sequence:CCGGCCTCTTCACATCCAATACCTTCTCGAGAAGGTATTGGATGTGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144556.2-298s1c1
Sequence:CCGGGCTTCTTAAAGATGCCGTCATCTCGAGATGACGGCATCTTTAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144556
LGI4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat LGI family, member 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144556.2-2100s1c1
Sequence:CCGGGAGCATTCCTTTCCACTTAAACTCGAGTTTAAGTGGAAAGGAATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216873    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-1449s1c1
Sequence:CCGGGTCTTCCAGCCACTACTAATTCTCGAGAATTAGTAGTGGCTGGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-681s1c1
Sequence:CCGGCTTGACCCTAAGAAGTTCAAGCTCGAGCTTGAACTTCTTAGGGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144556.2-1520s1c1
Sequence:CCGGCTTCCGCTTTGAGTCCGATAACTCGAGTTATCGGACTCAAAGCGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144556.2-1790s1c1
Sequence:CCGGCCTGTGTGATACAGACCACTACTCGAGTAGTGGTCTGTATCACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144556.2-329s1c1
Sequence:CCGGCCTCTTCACATCCAATACCTTCTCGAGAAGGTATTGGATGTGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144556.2-298s1c1
Sequence:CCGGGCTTCTTAAAGATGCCGTCATCTCGAGATGACGGCATCTTTAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)