EMAIL THIS PAGE TO A FRIEND

LGMN

legumain

66 Gene Product Result for
Synonyms: AEP LGMN1 PRSC1
UniProtKB ID: Q99538, O00123, Q9BTY1
Gene ID:
Human(5641) Summary: This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. [provided by RefSeq, Jul 2008]
Mouse(19141) legumain
Rat(63865) legumain
cow(281281) legumain
dog(480232) legumain
chicken(423418) legumain
sheep(678680) legumain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0708 Human LGMN / Legumain ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0906 AQUA Peptide DYTGEDVTPENFLAVL[R] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005606 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008530 Rosetta Predictions human pricing
NM_005606 Rosetta Predictions human pricing
NM_022226 Rosetta Predictions rat pricing
NM_011175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087748 predicted 859
2 SASI_Hs01_00087749 predicted 868
3 SASI_Hs01_00087750 predicted 1517
4 SASI_Hs01_00087751 predicted 1245
5 SASI_Hs01_00087752 predicted 1165
6 SASI_Hs01_00087753 predicted 832
7 SASI_Hs01_00087754 predicted 1143
8 SASI_Hs01_00087755 predicted 594
9 SASI_Hs01_00087756 predicted 1272
10 SASI_Hs01_00087757 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103734 predicted 736
2 SASI_Hs01_00103735 predicted 750
3 SASI_Hs01_00103736 predicted 1397
4 SASI_Hs01_00103737 predicted 1129
5 SASI_Hs01_00103738 predicted 1045
6 SASI_Hs01_00103739 predicted 713
7 SASI_Hs01_00103740 predicted 1024
8 SASI_Hs01_00103741 predicted 480
9 SASI_Hs01_00103742 predicted 1154
10 SASI_Hs01_00103743 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100103 predicted 1290
2 SASI_Rn01_00100104 predicted 1019
3 SASI_Rn01_00100105 predicted 375
4 SASI_Rn01_00100106 predicted 1298
5 SASI_Rn01_00100107 predicted 1080
6 SASI_Rn02_00262990 predicted 898
7 SASI_Rn01_00100109 predicted 1416
8 SASI_Rn01_00100110 predicted 311
9 SASI_Rn01_00100111 predicted 534
10 SASI_Rn01_00100112 predicted 369
11 SASI_Rn01_00100108 predicted 1042
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183992 predicted 1347
2 SASI_Mm01_00183993 predicted 888
3 SASI_Mm01_00183994 predicted 1243
4 SASI_Mm02_00320054 predicted 891
5 SASI_Mm01_00183995 predicted 1323
6 SASI_Mm01_00183997 predicted 425
7 SASI_Mm01_00183998 predicted 204
8 SASI_Mm01_00184000 predicted 602
9 SASI_Mm02_00320055 predicted 738
10 SASI_Mm02_00320056 predicted 1341
11 SASI_Mm01_00183991 predicted 640
12 SASI_Mm01_00183996 predicted 957
13 SASI_Mm01_00183999 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011175
VALIDATED
LGMN MISSION shRNA Bacterial Glycerol Stock
legumain
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-510s1c1
Sequence:CCGGCCCGAGATCATGTCTTCATTTCTCGAGAAATGAAGACATGATCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1371s1c1
Sequence:CCGGCCATGGACAAAGTGTGTCTTACTCGAGTAAGACACACTTTGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-595s1c1
Sequence:CCGGCCTGAATAAGACTATTCGCTACTCGAGTAGCGAATAGTCTTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1648s1c1
Sequence:CCGGCCATTAGCTTTCAAGAGCAAACTCGAGTTTGCTCTTGAAAGCTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1033s1c1
Sequence:CCGGCCTGACCATCTTGAAGAGGAACTCGAGTTCCTCTTCAAGATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-595s21c1
Sequence:CCGGCCTGAATAAGACTATTCGCTACTCGAGTAGCGAATAGTCTTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-510s21c1
Sequence:CCGGCCCGAGATCATGTCTTCATTTCTCGAGAAATGAAGACATGATCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011175.2-1649s21c1
Sequence:CCGGCCATTAGCTTTCAAGAGCAAACTCGAGTTTGCTCTTGAAAGCTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-1033s21c1
Sequence:CCGGCCTGACCATCTTGAAGAGGAACTCGAGTTCCTCTTCAAGATGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-1371s21c1
Sequence:CCGGCCATGGACAAAGTGTGTCTTACTCGAGTAAGACACACTTTGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011175
VALIDATED
LGMN MISSION shRNA shRNA Plasmid DNA
legumain
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-510s1c1
Sequence:CCGGCCCGAGATCATGTCTTCATTTCTCGAGAAATGAAGACATGATCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1371s1c1
Sequence:CCGGCCATGGACAAAGTGTGTCTTACTCGAGTAAGACACACTTTGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-595s1c1
Sequence:CCGGCCTGAATAAGACTATTCGCTACTCGAGTAGCGAATAGTCTTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1648s1c1
Sequence:CCGGCCATTAGCTTTCAAGAGCAAACTCGAGTTTGCTCTTGAAAGCTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1033s1c1
Sequence:CCGGCCTGACCATCTTGAAGAGGAACTCGAGTTCCTCTTCAAGATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-595s21c1
Sequence:CCGGCCTGAATAAGACTATTCGCTACTCGAGTAGCGAATAGTCTTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-510s21c1
Sequence:CCGGCCCGAGATCATGTCTTCATTTCTCGAGAAATGAAGACATGATCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011175.2-1649s21c1
Sequence:CCGGCCATTAGCTTTCAAGAGCAAACTCGAGTTTGCTCTTGAAAGCTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-1033s21c1
Sequence:CCGGCCTGACCATCTTGAAGAGGAACTCGAGTTCCTCTTCAAGATGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-1371s21c1
Sequence:CCGGCCATGGACAAAGTGTGTCTTACTCGAGTAAGACACACTTTGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011175
VALIDATED
LGMN MISSION shRNA Lentiviral Transduction Particles
legumain
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-510s1c1
Sequence:CCGGCCCGAGATCATGTCTTCATTTCTCGAGAAATGAAGACATGATCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1371s1c1
Sequence:CCGGCCATGGACAAAGTGTGTCTTACTCGAGTAAGACACACTTTGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-595s1c1
Sequence:CCGGCCTGAATAAGACTATTCGCTACTCGAGTAGCGAATAGTCTTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1648s1c1
Sequence:CCGGCCATTAGCTTTCAAGAGCAAACTCGAGTTTGCTCTTGAAAGCTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011175.1-1033s1c1
Sequence:CCGGCCTGACCATCTTGAAGAGGAACTCGAGTTCCTCTTCAAGATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-595s21c1
Sequence:CCGGCCTGAATAAGACTATTCGCTACTCGAGTAGCGAATAGTCTTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-510s21c1
Sequence:CCGGCCCGAGATCATGTCTTCATTTCTCGAGAAATGAAGACATGATCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011175.2-1649s21c1
Sequence:CCGGCCATTAGCTTTCAAGAGCAAACTCGAGTTTGCTCTTGAAAGCTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-1033s21c1
Sequence:CCGGCCTGACCATCTTGAAGAGGAACTCGAGTTCCTCTTCAAGATGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011175.2-1371s21c1
Sequence:CCGGCCATGGACAAAGTGTGTCTTACTCGAGTAAGACACACTTTGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005606
VALIDATED
LGMN MISSION shRNA Bacterial Glycerol Stock
legumain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-936s1c1
Sequence:CCGGCCACGTCATGCAGTATGGAAACTCGAGTTTCCATACTGCATGACGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-360s1c1
Sequence:CCGGCATTGCTTACTCTGAAGACAACTCGAGTTGTCTTCAGAGTAAGCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-1385s1c1
Sequence:CCGGCGTATCCACTTCACAGGATAACTCGAGTTATCCTGTGAAGTGGATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-792s1c1
Sequence:CCGGCGCCTGTTACTATGATGAGAACTCGAGTTCTCATCATAGTAACAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005606.3-735s1c1
Sequence:CCGGGCCGGATAACATCAATGTTTACTCGAGTAAACATTGATGTTATCCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-357s21c1
Sequence:CCGGGCCATGCCTACCAGATCATTCCTCGAGGAATGATCTGGTAGGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-1733s21c1
Sequence:CCGGGTATTGAGAAGGGTCATATTTCTCGAGAAATATGACCCTTCTCAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005606.5-859s21c1
Sequence:CCGGCGCCTGTTACTATGATGAGAACTCGAGTTCTCATCATAGTAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-313s21c1
Sequence:CCGGAGGTTCAAATGGCTGGTATAACTCGAGTTATACCAGCCATTTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005606
VALIDATED
LGMN MISSION shRNA shRNA Plasmid DNA
legumain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-936s1c1
Sequence:CCGGCCACGTCATGCAGTATGGAAACTCGAGTTTCCATACTGCATGACGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-360s1c1
Sequence:CCGGCATTGCTTACTCTGAAGACAACTCGAGTTGTCTTCAGAGTAAGCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-1385s1c1
Sequence:CCGGCGTATCCACTTCACAGGATAACTCGAGTTATCCTGTGAAGTGGATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-792s1c1
Sequence:CCGGCGCCTGTTACTATGATGAGAACTCGAGTTCTCATCATAGTAACAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005606.3-735s1c1
Sequence:CCGGGCCGGATAACATCAATGTTTACTCGAGTAAACATTGATGTTATCCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-357s21c1
Sequence:CCGGGCCATGCCTACCAGATCATTCCTCGAGGAATGATCTGGTAGGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-1733s21c1
Sequence:CCGGGTATTGAGAAGGGTCATATTTCTCGAGAAATATGACCCTTCTCAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005606.5-859s21c1
Sequence:CCGGCGCCTGTTACTATGATGAGAACTCGAGTTCTCATCATAGTAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-313s21c1
Sequence:CCGGAGGTTCAAATGGCTGGTATAACTCGAGTTATACCAGCCATTTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005606
VALIDATED
LGMN MISSION shRNA Lentiviral Transduction Particles
legumain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-936s1c1
Sequence:CCGGCCACGTCATGCAGTATGGAAACTCGAGTTTCCATACTGCATGACGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-360s1c1
Sequence:CCGGCATTGCTTACTCTGAAGACAACTCGAGTTGTCTTCAGAGTAAGCAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-1385s1c1
Sequence:CCGGCGTATCCACTTCACAGGATAACTCGAGTTATCCTGTGAAGTGGATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005606.3-792s1c1
Sequence:CCGGCGCCTGTTACTATGATGAGAACTCGAGTTCTCATCATAGTAACAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005606.3-735s1c1
Sequence:CCGGGCCGGATAACATCAATGTTTACTCGAGTAAACATTGATGTTATCCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-357s21c1
Sequence:CCGGGCCATGCCTACCAGATCATTCCTCGAGGAATGATCTGGTAGGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-1733s21c1
Sequence:CCGGGTATTGAGAAGGGTCATATTTCTCGAGAAATATGACCCTTCTCAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005606.5-859s21c1
Sequence:CCGGCGCCTGTTACTATGATGAGAACTCGAGTTCTCATCATAGTAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005606.5-313s21c1
Sequence:CCGGAGGTTCAAATGGCTGGTATAACTCGAGTTATACCAGCCATTTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)