EMAIL THIS PAGE TO A FRIEND

LGR4

leucine-rich repeat containing G protein-coupled receptor 4

182 Gene Product Result for
Synonyms: BNMD17 GPR48
UniProtKB ID: Q9BXB1, A6NCH3, G5E9B3, Q8N537, Q9NYD1
Gene ID:
Human(55366) Summary: G protein-coupled receptors (GPCRs) play key roles in a variety of physiologic functions. Members of the leucine-rich GPCR (LGR) family, such as GPR48, have multiple N-terminal leucine-rich repeats (LRRs) and a 7-transmembrane domain (Weng et al., 2008 [PubMed 18424556]
Mouse(107515) leucine-rich repeat-containing G protein-coupled receptor 4
Rat(286994) leucine-rich repeat-containing G protein-coupled receptor 4
Zebrafish(558825) leucine-rich repeat-containing G protein-coupled receptor 4
domestic cat(101083964) leucine-rich repeat containing G protein-coupled receptor 4
cow(505423) leucine-rich repeat containing G protein-coupled receptor 4
Horse(100072305) leucine-rich repeat containing G protein-coupled receptor 4
dog(476896) leucine-rich repeat containing G protein-coupled receptor 4
chicken(428605) leucine-rich repeat containing G protein-coupled receptor 4
sheep(101110791) leucine-rich repeat containing G protein-coupled receptor 4
Domestic Rabbit(100356429) leucine-rich repeat containing G protein-coupled receptor 4
domestic guinea pig(100724174) leucine-rich repeat containing G protein-coupled receptor 4
naked mole-rat(101703145) leucine-rich repeat containing G protein-coupled receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018490 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018490 Rosetta Predictions human pricing
NM_173328 Rosetta Predictions rat pricing
NM_172671 Rosetta Predictions mouse pricing
XM_355385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043670 predicted 2649
2 SASI_Hs02_00352078 predicted 1528
3 SASI_Hs01_00043671 predicted 1730
4 SASI_Hs02_00352079 predicted 1517
5 SASI_Hs01_00043672 predicted 2103
6 SASI_Hs02_00352080 predicted 1481
7 SASI_Hs01_00043674 predicted 1712
8 SASI_Hs01_00043675 predicted 1626
9 SASI_Hs02_00352081 predicted 1780
10 SASI_Hs01_00043676 predicted 884
11 SASI_Hs01_00043673 predicted 1136
12 SASI_Hs01_00043677 predicted 2159
13 SASI_Hs01_00043678 predicted 1305
14 SASI_Hs01_00043679 predicted 2827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045083 predicted 404
2 SASI_Rn01_00045084 predicted 439
3 SASI_Rn01_00045085 predicted 862
4 SASI_Rn01_00045086 predicted 1330
5 SASI_Rn01_00045087 predicted 1092
6 SASI_Rn01_00045089 predicted 1346
7 SASI_Rn01_00045090 predicted 1417
8 SASI_Rn01_00045091 predicted 797
9 SASI_Rn01_00045092 predicted 1845
10 SASI_Rn02_00269450 predicted 242
11 SASI_Rn01_00045088 predicted 2486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344384 predicted 674
2 SASI_Mm02_00344385 predicted 827
3 SASI_Mm02_00344386 predicted 2650
4 SASI_Mm02_00344387 predicted 873
5 SASI_Mm02_00344388 predicted 1607
6 SASI_Mm02_00344389 predicted 2772
7 SASI_Mm02_00344390 predicted 2606
8 SASI_Mm02_00344391 predicted 1766
9 SASI_Mm02_00344392 predicted 2095
10 SASI_Mm02_00344393 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229037 predicted 1565
2 SASI_Mm01_00229038 predicted 871
3 SASI_Mm01_00229039 predicted 729
4 SASI_Mm01_00229040 predicted 2853
5 SASI_Mm01_00229041 predicted 2696
6 SASI_Mm01_00229042 predicted 915
7 SASI_Mm01_00229043 predicted 2824
8 SASI_Mm01_00229044 predicted 2648
9 SASI_Mm01_00229045 predicted 1804
10 SASI_Mm01_00229046 predicted 2140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172671
LGR4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat containing G protein-coupled receptor 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1773s21c1
Sequence:CCGGGAATGGGCTCAATCAACTTAACTCGAGTTAAGTTGATTGAGCCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3587s21c1
Sequence:CCGGTGATGTATGGCATAGCAATATCTCGAGATATTGCTATGCCATACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1189s21c1
Sequence:CCGGGAATTTCCTCAGGCTATTAAACTCGAGTTTAATAGCCTGAGGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3490s21c1
Sequence:CCGGGTGAAGAATGGGAGCCTAAAGCTCGAGCTTTAGGCTCCCATTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3642s21c1
Sequence:CCGGCATCAGGTGCAAAGTTCAAATCTCGAGATTTGAACTTTGCACCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1512s21c1
Sequence:CCGGGACTCTGGACTTATCTTATAACTCGAGTTATAAGATAAGTCCAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1290s21c1
Sequence:CCGGACTGCTAAGAACTATCCATTTCTCGAGAAATGGATAGTTCTTAGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172671
LGR4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat containing G protein-coupled receptor 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1773s21c1
Sequence:CCGGGAATGGGCTCAATCAACTTAACTCGAGTTAAGTTGATTGAGCCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3587s21c1
Sequence:CCGGTGATGTATGGCATAGCAATATCTCGAGATATTGCTATGCCATACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1189s21c1
Sequence:CCGGGAATTTCCTCAGGCTATTAAACTCGAGTTTAATAGCCTGAGGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3490s21c1
Sequence:CCGGGTGAAGAATGGGAGCCTAAAGCTCGAGCTTTAGGCTCCCATTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3642s21c1
Sequence:CCGGCATCAGGTGCAAAGTTCAAATCTCGAGATTTGAACTTTGCACCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1512s21c1
Sequence:CCGGGACTCTGGACTTATCTTATAACTCGAGTTATAAGATAAGTCCAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1290s21c1
Sequence:CCGGACTGCTAAGAACTATCCATTTCTCGAGAAATGGATAGTTCTTAGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172671
LGR4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat containing G protein-coupled receptor 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1773s21c1
Sequence:CCGGGAATGGGCTCAATCAACTTAACTCGAGTTAAGTTGATTGAGCCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414211    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3587s21c1
Sequence:CCGGTGATGTATGGCATAGCAATATCTCGAGATATTGCTATGCCATACATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1189s21c1
Sequence:CCGGGAATTTCCTCAGGCTATTAAACTCGAGTTTAATAGCCTGAGGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3490s21c1
Sequence:CCGGGTGAAGAATGGGAGCCTAAAGCTCGAGCTTTAGGCTCCCATTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172671.2-3642s21c1
Sequence:CCGGCATCAGGTGCAAAGTTCAAATCTCGAGATTTGAACTTTGCACCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1512s21c1
Sequence:CCGGGACTCTGGACTTATCTTATAACTCGAGTTATAAGATAAGTCCAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172671.2-1290s21c1
Sequence:CCGGACTGCTAAGAACTATCCATTTCTCGAGAAATGGATAGTTCTTAGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018490
VALIDATED
LGR4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat containing G protein-coupled receptor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-866s21c1
Sequence:CCGGGCTGAGTGCTTTGCAGTCTTTCTCGAGAAAGACTGCAAAGCACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018490.2-1604s21c1
Sequence:CCGGGCGTAATCAAATCTACCAAATCTCGAGATTTGGTAGATTTGATTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-889s21c1
Sequence:CCGGGTTTAGATGCCAACCATATTACTCGAGTAATATGGTTGGCATCTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-3500s21c1
Sequence:CCGGCAAAGAACAGGTGCCTAAATTCTCGAGAATTTAGGCACCTGTTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-1684s1c1
Sequence:CCGGCCAATAACTAACCTAGATGTACTCGAGTACATCTAGGTTAGTTATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018490.1-4642s1c1
Sequence:CCGGCCAGCTAGATTGCAGTTTAATCTCGAGATTAAACTGCAATCTAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-1563s1c1
Sequence:CCGGGCGTAATCAAATCTACCAAATCTCGAGATTTGGTAGATTTGATTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-2609s1c1
Sequence:CCGGCCGTTATCTACACTAAGCTATCTCGAGATAGCTTAGTGTAGATAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-825s1c1
Sequence:CCGGGCTGAGTGCTTTGCAGTCTTTCTCGAGAAAGACTGCAAAGCACTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018490
VALIDATED
LGR4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat containing G protein-coupled receptor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-866s21c1
Sequence:CCGGGCTGAGTGCTTTGCAGTCTTTCTCGAGAAAGACTGCAAAGCACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018490.2-1604s21c1
Sequence:CCGGGCGTAATCAAATCTACCAAATCTCGAGATTTGGTAGATTTGATTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-889s21c1
Sequence:CCGGGTTTAGATGCCAACCATATTACTCGAGTAATATGGTTGGCATCTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-3500s21c1
Sequence:CCGGCAAAGAACAGGTGCCTAAATTCTCGAGAATTTAGGCACCTGTTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-1684s1c1
Sequence:CCGGCCAATAACTAACCTAGATGTACTCGAGTACATCTAGGTTAGTTATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018490.1-4642s1c1
Sequence:CCGGCCAGCTAGATTGCAGTTTAATCTCGAGATTAAACTGCAATCTAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-1563s1c1
Sequence:CCGGGCGTAATCAAATCTACCAAATCTCGAGATTTGGTAGATTTGATTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-2609s1c1
Sequence:CCGGCCGTTATCTACACTAAGCTATCTCGAGATAGCTTAGTGTAGATAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-825s1c1
Sequence:CCGGGCTGAGTGCTTTGCAGTCTTTCTCGAGAAAGACTGCAAAGCACTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018490
VALIDATED
LGR4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat containing G protein-coupled receptor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-866s21c1
Sequence:CCGGGCTGAGTGCTTTGCAGTCTTTCTCGAGAAAGACTGCAAAGCACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018490.2-1604s21c1
Sequence:CCGGGCGTAATCAAATCTACCAAATCTCGAGATTTGGTAGATTTGATTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-889s21c1
Sequence:CCGGGTTTAGATGCCAACCATATTACTCGAGTAATATGGTTGGCATCTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018490.2-3500s21c1
Sequence:CCGGCAAAGAACAGGTGCCTAAATTCTCGAGAATTTAGGCACCTGTTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-1684s1c1
Sequence:CCGGCCAATAACTAACCTAGATGTACTCGAGTACATCTAGGTTAGTTATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018490.1-4642s1c1
Sequence:CCGGCCAGCTAGATTGCAGTTTAATCTCGAGATTAAACTGCAATCTAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-1563s1c1
Sequence:CCGGGCGTAATCAAATCTACCAAATCTCGAGATTTGGTAGATTTGATTACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-2609s1c1
Sequence:CCGGCCGTTATCTACACTAAGCTATCTCGAGATAGCTTAGTGTAGATAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_018490.1-825s1c1
Sequence:CCGGGCTGAGTGCTTTGCAGTCTTTCTCGAGAAAGACTGCAAAGCACTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355385
VALIDATED
LGR4 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat containing G protein-coupled receptor 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355385.1-4363s1c1
Sequence:CCGGGCCTTGTAAATAGTCTTGGTTCTCGAGAACCAAGACTATTTACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-1774s1c1
Sequence:CCGGGCATCTATACTGGCATCCTTACTCGAGTAAGGATGCCAGTATAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-344s1c1
Sequence:CCGGCCTCCAGAACAATCAGTTGAACTCGAGTTCAACTGATTGTTCTGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-1131s1c1
Sequence:CCGGCGTAATCAAATCTCCCTGATACTCGAGTATCAGGGAGATTTGATTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-2346s1c1
Sequence:CCGGCCCGAGATAATGAAGTCTGTTCTCGAGAACAGACTTCATTATCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355385
VALIDATED
LGR4 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat containing G protein-coupled receptor 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355385.1-4363s1c1
Sequence:CCGGGCCTTGTAAATAGTCTTGGTTCTCGAGAACCAAGACTATTTACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-1774s1c1
Sequence:CCGGGCATCTATACTGGCATCCTTACTCGAGTAAGGATGCCAGTATAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-344s1c1
Sequence:CCGGCCTCCAGAACAATCAGTTGAACTCGAGTTCAACTGATTGTTCTGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-1131s1c1
Sequence:CCGGCGTAATCAAATCTCCCTGATACTCGAGTATCAGGGAGATTTGATTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-2346s1c1
Sequence:CCGGCCCGAGATAATGAAGTCTGTTCTCGAGAACAGACTTCATTATCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355385
VALIDATED
LGR4 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat containing G protein-coupled receptor 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004661    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355385.1-4363s1c1
Sequence:CCGGGCCTTGTAAATAGTCTTGGTTCTCGAGAACCAAGACTATTTACAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-1774s1c1
Sequence:CCGGGCATCTATACTGGCATCCTTACTCGAGTAAGGATGCCAGTATAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-344s1c1
Sequence:CCGGCCTCCAGAACAATCAGTTGAACTCGAGTTCAACTGATTGTTCTGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-1131s1c1
Sequence:CCGGCGTAATCAAATCTCCCTGATACTCGAGTATCAGGGAGATTTGATTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_355385.1-2346s1c1
Sequence:CCGGCCCGAGATAATGAAGTCTGTTCTCGAGAACAGACTTCATTATCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)