EMAIL THIS PAGE TO A FRIEND

LGR5

leucine-rich repeat containing G protein-coupled receptor 5

172 Gene Product Result for
Synonyms: FEX GPR49 GPR67 GRP49 HG38
UniProtKB ID: O75473, Q4VAM0, Q4VAM2, Q9UP75
Gene ID:
Mouse(14160) leucine rich repeat containing G protein coupled receptor 5
Rat(299802) leucine rich repeat containing G protein coupled receptor 5
domestic guinea pig(100719443) leucine-rich repeat containing G protein-coupled receptor 5
naked mole-rat(101717513) leucine-rich repeat containing G protein-coupled receptor 5
sheep(101121592) leucine-rich repeat containing G protein-coupled receptor 5
chicken(427867) leucine-rich repeat containing G protein-coupled receptor 5
dog(609478) leucine-rich repeat containing G protein-coupled receptor 5
domestic cat(101080720) leucine-rich repeat containing G protein-coupled receptor 5
cow(520189) leucine-rich repeat containing G protein-coupled receptor 5
Horse(100064565) leucine-rich repeat containing G protein-coupled receptor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700211 Anti-LGR5 (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
western blot pricing
SAB1305045 ANTI-LGR5 (GPR49) (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1303599 ANTI-LGR5 (GPR49) (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1303676 ANTI-LGR5 (GPR49) (LOOP1) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA012530 Anti-LGR5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1304855 ANTI-LGR5/GPR49 (LOOP1) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1302822 ANTI-LGR5/GPR49 (LOOP2) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1302821 ANTI-LGR5/GPR49 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306733 ANTI-LGR5/GPR49 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306732 ANTI-LGR5/GPR49 antibody produced in mouse crude ascites, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003667 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003667 Rosetta Predictions human pricing
NM_001106784 Rosetta Predictions rat pricing
NM_010195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199804 predicted 2211
2 SASI_Hs01_00199805 predicted 1069
3 SASI_Hs01_00199806 predicted 321
4 SASI_Hs01_00199807 predicted 1405
5 SASI_Hs02_00336052 predicted 1502
6 SASI_Hs01_00199809 predicted 266
7 SASI_Hs01_00199810 predicted 923
8 SASI_Hs01_00199811 predicted 1570
9 SASI_Hs01_00199812 predicted 823
10 SASI_Hs02_00336053 predicted 1122
11 SASI_Hs01_00199808 predicted 1139
12 SASI_Hs01_00199813 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222368 predicted 2263
2 SASI_Rn02_00222369 predicted 1205
3 SASI_Rn02_00222370 predicted 844
4 SASI_Rn02_00222371 predicted 1263
5 SASI_Rn02_00222372 predicted 1514
6 SASI_Rn02_00222373 predicted 2379
7 SASI_Rn02_00222374 predicted 2167
8 SASI_Rn02_00222375 predicted 2365
9 SASI_Rn02_00222376 predicted 1249
10 SASI_Rn02_00222377 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182450 predicted 1646
2 SASI_Mm02_00318004 predicted 880
3 SASI_Mm01_00182451 predicted 2278
4 SASI_Mm01_00182452 predicted 1083
5 SASI_Mm01_00182453 predicted 1605
6 SASI_Mm01_00182454 predicted 2285
7 SASI_Mm01_00182455 predicted 1160
8 SASI_Mm01_00182456 predicted 1133
9 SASI_Mm01_00182457 predicted 1067
10 SASI_Mm01_00182458 predicted 2654
11 SASI_Mm01_00182459 predicted 2399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003667
LGR5 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat containing G protein-coupled receptor 5
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1242s21c1
Sequence:CCGGTAGCCTCCGATCGCTGAATTTCTCGAGAAATTCAGCGATCGGAGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2325s21c1
Sequence:CCGGTTGGGACTGCTCTATGGTAAACTCGAGTTTACCATAGAGCAGTCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-983s21c1
Sequence:CCGGTGAATGGTGCCTCACAAATAACTCGAGTTATTTGTGAGGCACCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2084s21c1
Sequence:CCGGCTAGCCTGAAAGTAATCATTTCTCGAGAAATGATTACTTTCAGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2433s21c1
Sequence:CCGGTATCAGTCCTGAAGTAATTAACTCGAGTTAATTACTTCAGGACTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-1085s1c1
Sequence:CCGGCCGTCTGCAATCAGTTACCTACTCGAGTAGGTAACTGATTGCAGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2662s21c1
Sequence:CCGGACCAGCTCCAGCATCACTTATCTCGAGATAAGTGATGCTGGAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-1745s1c1
Sequence:CCGGCCATAGCAGTTCTGGCACTTACTCGAGTAAGTGCCAGAACTGCTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-2286s1c1
Sequence:CCGGGCTCTACTGCAATTTGGACAACTCGAGTTGTCCAAATTGCAGTAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-2425s1c1
Sequence:CCGGCTTACATTTATCAGTCCTGAACTCGAGTTCAGGACTGATAAATGTAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-923s1c1
Sequence:CCGGCCATCCAATTTGTTGGGAGATCTCGAGATCTCCCAACAAATTGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-752s21c1
Sequence:CCGGGCCTAGAGACTTTAGATTTAACTCGAGTTAAATCTAAAGTCTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1441s21c1
Sequence:CCGGTTTCCAGAACTCAAGGTTATACTCGAGTATAACCTTGAGTTCTGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2586s21c1
Sequence:CCGGCCCAAGCTTGATGTCAATTAACTCGAGTTAATTGACATCAAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1120s21c1
Sequence:CCGGGATCTGTCTTACAACCTATTACTCGAGTAATAGGTTGTAAGACAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003667
LGR5 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat containing G protein-coupled receptor 5
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1242s21c1
Sequence:CCGGTAGCCTCCGATCGCTGAATTTCTCGAGAAATTCAGCGATCGGAGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2325s21c1
Sequence:CCGGTTGGGACTGCTCTATGGTAAACTCGAGTTTACCATAGAGCAGTCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-983s21c1
Sequence:CCGGTGAATGGTGCCTCACAAATAACTCGAGTTATTTGTGAGGCACCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2084s21c1
Sequence:CCGGCTAGCCTGAAAGTAATCATTTCTCGAGAAATGATTACTTTCAGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2433s21c1
Sequence:CCGGTATCAGTCCTGAAGTAATTAACTCGAGTTAATTACTTCAGGACTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-1085s1c1
Sequence:CCGGCCGTCTGCAATCAGTTACCTACTCGAGTAGGTAACTGATTGCAGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2662s21c1
Sequence:CCGGACCAGCTCCAGCATCACTTATCTCGAGATAAGTGATGCTGGAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-1745s1c1
Sequence:CCGGCCATAGCAGTTCTGGCACTTACTCGAGTAAGTGCCAGAACTGCTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-2286s1c1
Sequence:CCGGGCTCTACTGCAATTTGGACAACTCGAGTTGTCCAAATTGCAGTAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-2425s1c1
Sequence:CCGGCTTACATTTATCAGTCCTGAACTCGAGTTCAGGACTGATAAATGTAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-923s1c1
Sequence:CCGGCCATCCAATTTGTTGGGAGATCTCGAGATCTCCCAACAAATTGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-752s21c1
Sequence:CCGGGCCTAGAGACTTTAGATTTAACTCGAGTTAAATCTAAAGTCTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1441s21c1
Sequence:CCGGTTTCCAGAACTCAAGGTTATACTCGAGTATAACCTTGAGTTCTGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2586s21c1
Sequence:CCGGCCCAAGCTTGATGTCAATTAACTCGAGTTAATTGACATCAAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1120s21c1
Sequence:CCGGGATCTGTCTTACAACCTATTACTCGAGTAATAGGTTGTAAGACAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003667
LGR5 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat containing G protein-coupled receptor 5
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1242s21c1
Sequence:CCGGTAGCCTCCGATCGCTGAATTTCTCGAGAAATTCAGCGATCGGAGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2325s21c1
Sequence:CCGGTTGGGACTGCTCTATGGTAAACTCGAGTTTACCATAGAGCAGTCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-983s21c1
Sequence:CCGGTGAATGGTGCCTCACAAATAACTCGAGTTATTTGTGAGGCACCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2084s21c1
Sequence:CCGGCTAGCCTGAAAGTAATCATTTCTCGAGAAATGATTACTTTCAGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2433s21c1
Sequence:CCGGTATCAGTCCTGAAGTAATTAACTCGAGTTAATTACTTCAGGACTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-1085s1c1
Sequence:CCGGCCGTCTGCAATCAGTTACCTACTCGAGTAGGTAACTGATTGCAGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2662s21c1
Sequence:CCGGACCAGCTCCAGCATCACTTATCTCGAGATAAGTGATGCTGGAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-1745s1c1
Sequence:CCGGCCATAGCAGTTCTGGCACTTACTCGAGTAAGTGCCAGAACTGCTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-2286s1c1
Sequence:CCGGGCTCTACTGCAATTTGGACAACTCGAGTTGTCCAAATTGCAGTAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-2425s1c1
Sequence:CCGGCTTACATTTATCAGTCCTGAACTCGAGTTCAGGACTGATAAATGTAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003667.2-923s1c1
Sequence:CCGGCCATCCAATTTGTTGGGAGATCTCGAGATCTCCCAACAAATTGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-752s21c1
Sequence:CCGGGCCTAGAGACTTTAGATTTAACTCGAGTTAAATCTAAAGTCTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1441s21c1
Sequence:CCGGTTTCCAGAACTCAAGGTTATACTCGAGTATAACCTTGAGTTCTGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-2586s21c1
Sequence:CCGGCCCAAGCTTGATGTCAATTAACTCGAGTTAATTGACATCAAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003667.2-1120s21c1
Sequence:CCGGGATCTGTCTTACAACCTATTACTCGAGTAATAGGTTGTAAGACAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010195
VALIDATED
LGR5 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat containing G protein-coupled receptor 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2826s21c1
Sequence:CCGGGCGAGTCTGCTGTCCATTAACCTCGAGGTTAATGGACAGCAGACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010195.1-2671s1c1
Sequence:CCGGCCCATGACTGAAAGCTGTCATCTCGAGATGACAGCTTTCAGTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-1531s1c1
Sequence:CCGGGCTGGGTTATTTCAAGTTCAACTCGAGTTGAACTTGAAATAACCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-943s1c1
Sequence:CCGGGCCTCGCACATTACTGAATTTCTCGAGAAATTCAGTAATGTGCGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-875s1c1
Sequence:CCGGCCATCCAATTTGTTGGAGTATCTCGAGATACTCCAACAAATTGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010195.1-2594s1c1
Sequence:CCGGCCCAAGCCTTAGTATCCTTTACTCGAGTAAAGGATACTAAGGCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010195.2-1541s21c1
Sequence:CCGGTTCTACGTTGCCGTCTCTAATCTCGAGATTAGAGACGGCAACGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-3326s21c1
Sequence:CCGGATGACTCAATGGGTGTATTTACTCGAGTAAATACACCCATTGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2672s21c1
Sequence:CCGGTATCAGTCCTGACGTCATTAACTCGAGTTAATGACGTCAGGACTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2958s21c1
Sequence:CCGGCCCATGACTGAAAGCTGTCATCTCGAGATGACAGCTTTCAGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010195
VALIDATED
LGR5 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat containing G protein-coupled receptor 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2826s21c1
Sequence:CCGGGCGAGTCTGCTGTCCATTAACCTCGAGGTTAATGGACAGCAGACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010195.1-2671s1c1
Sequence:CCGGCCCATGACTGAAAGCTGTCATCTCGAGATGACAGCTTTCAGTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-1531s1c1
Sequence:CCGGGCTGGGTTATTTCAAGTTCAACTCGAGTTGAACTTGAAATAACCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-943s1c1
Sequence:CCGGGCCTCGCACATTACTGAATTTCTCGAGAAATTCAGTAATGTGCGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-875s1c1
Sequence:CCGGCCATCCAATTTGTTGGAGTATCTCGAGATACTCCAACAAATTGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010195.1-2594s1c1
Sequence:CCGGCCCAAGCCTTAGTATCCTTTACTCGAGTAAAGGATACTAAGGCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010195.2-1541s21c1
Sequence:CCGGTTCTACGTTGCCGTCTCTAATCTCGAGATTAGAGACGGCAACGTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-3326s21c1
Sequence:CCGGATGACTCAATGGGTGTATTTACTCGAGTAAATACACCCATTGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2672s21c1
Sequence:CCGGTATCAGTCCTGACGTCATTAACTCGAGTTAATGACGTCAGGACTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2958s21c1
Sequence:CCGGCCCATGACTGAAAGCTGTCATCTCGAGATGACAGCTTTCAGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010195
VALIDATED
LGR5 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat containing G protein-coupled receptor 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2826s21c1
Sequence:CCGGGCGAGTCTGCTGTCCATTAACCTCGAGGTTAATGGACAGCAGACTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010195.1-2671s1c1
Sequence:CCGGCCCATGACTGAAAGCTGTCATCTCGAGATGACAGCTTTCAGTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-1531s1c1
Sequence:CCGGGCTGGGTTATTTCAAGTTCAACTCGAGTTGAACTTGAAATAACCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-943s1c1
Sequence:CCGGGCCTCGCACATTACTGAATTTCTCGAGAAATTCAGTAATGTGCGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010195.1-875s1c1
Sequence:CCGGCCATCCAATTTGTTGGAGTATCTCGAGATACTCCAACAAATTGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010195.1-2594s1c1
Sequence:CCGGCCCAAGCCTTAGTATCCTTTACTCGAGTAAAGGATACTAAGGCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010195.2-1541s21c1
Sequence:CCGGTTCTACGTTGCCGTCTCTAATCTCGAGATTAGAGACGGCAACGTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-3326s21c1
Sequence:CCGGATGACTCAATGGGTGTATTTACTCGAGTAAATACACCCATTGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2672s21c1
Sequence:CCGGTATCAGTCCTGACGTCATTAACTCGAGTTAATGACGTCAGGACTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010195.2-2958s21c1
Sequence:CCGGCCCATGACTGAAAGCTGTCATCTCGAGATGACAGCTTTCAGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)