EMAIL THIS PAGE TO A FRIEND

LGSN

lengsin, lens protein with glutamine synthetase domain

78 Gene Product Result for
Synonyms: GLULD1 LGS
UniProtKB ID: Q5TDP6, A1L421, Q0PVN9, Q0PVP0, Q9NYJ0
Gene ID:
Human(51557) Summary: This gene encodes a protein with similarity to the GS I members of the glutamine synthetase superfamily. The encoded protein is referred to as a pseudo-glutamine synthetase because it has no glutamine synthesis activity and may function as a chaperone protein. This protein is localized to the lens and may be associated with cataract disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Mouse(266744) lengsin, lens protein with glutamine synthetase domain
Rat(316304) lengsin, lens protein with glutamine synthetase domain
Zebrafish(567024) lengsin, lens protein with glutamine synthetase domain
Horse(100070378) lengsin, lens protein with glutamine synthetase domain
domestic cat(101101469) lengsin, lens protein with glutamine synthetase domain
dog(481862) lengsin, lens protein with glutamine synthetase domain
chicken(428642) lengsin, lens protein with glutamine synthetase domain
domestic guinea pig(100307117) lengsin, lens protein with glutamine synthetase domain
naked mole-rat(101723805) lengsin, lens protein with glutamine synthetase domain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A7275 L-2-Aminoadipic acid ≥98% (TLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016571 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149041 MISSION® esiRNA esiRNA human LGSN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016571 Rosetta Predictions human pricing
NM_181383 Rosetta Predictions rat pricing
NM_153601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123279 predicted 1313
2 SASI_Hs01_00123280 predicted 635
3 SASI_Hs02_00349700 predicted 517
4 SASI_Hs01_00123281 predicted 857
5 SASI_Hs01_00123282 predicted 1113
6 SASI_Hs01_00123283 predicted 882
7 SASI_Hs01_00123285 predicted 1156
8 SASI_Hs01_00123286 predicted 771
9 SASI_Hs01_00123287 predicted 248
10 SASI_Hs01_00123288 predicted 1135
11 SASI_Hs01_00123284 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071967 predicted 1614
2 SASI_Rn01_00071968 predicted 869
3 SASI_Rn01_00071969 predicted 273
4 SASI_Rn01_00071971 predicted 1135
5 SASI_Rn02_00269728 predicted 401
6 SASI_Rn01_00071973 predicted 548
7 SASI_Rn02_00269729 predicted 1022
8 SASI_Rn01_00071974 predicted 1082
9 SASI_Rn01_00071976 predicted 391
10 SASI_Rn02_00269730 predicted 451
11 SASI_Rn01_00071970 predicted 1352
12 SASI_Rn01_00071972 predicted 562
13 SASI_Rn01_00071975 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343454 predicted 226
2 SASI_Mm02_00343455 predicted 1608
3 SASI_Mm02_00343456 predicted 440
4 SASI_Mm02_00343457 predicted 571
5 SASI_Mm02_00343458 predicted 859
6 SASI_Mm02_00343459 predicted 547
7 SASI_Mm02_00343460 predicted 448
8 SASI_Mm02_00343461 predicted 1615
9 SASI_Mm02_00343462 predicted 1001
10 SASI_Mm02_00343463 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153601
LGSN MISSION shRNA Bacterial Glycerol Stock
lengsin, lens protein with glutamine synthetase domain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-597s1c1
Sequence:CCGGCCACATGCTTCAATAGTGATACTCGAGTATCACTATTGAAGCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-566s1c1
Sequence:CCGGCCTAAGGACAATGAGGTGAATCTCGAGATTCACCTCATTGTCCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-1080s1c1
Sequence:CCGGGCCTTGTAATTGAGACTGGATCTCGAGATCCAGTCTCAATTACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-375s1c1
Sequence:CCGGCGCCTCAACTTTCTGCTAGAACTCGAGTTCTAGCAGAAAGTTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153601.1-1722s1c1
Sequence:CCGGCCTGTAGAGATATGATGAGTACTCGAGTACTCATCATATCTCTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153601
LGSN MISSION shRNA shRNA Plasmid DNA
lengsin, lens protein with glutamine synthetase domain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-597s1c1
Sequence:CCGGCCACATGCTTCAATAGTGATACTCGAGTATCACTATTGAAGCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-566s1c1
Sequence:CCGGCCTAAGGACAATGAGGTGAATCTCGAGATTCACCTCATTGTCCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-1080s1c1
Sequence:CCGGGCCTTGTAATTGAGACTGGATCTCGAGATCCAGTCTCAATTACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-375s1c1
Sequence:CCGGCGCCTCAACTTTCTGCTAGAACTCGAGTTCTAGCAGAAAGTTGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153601.1-1722s1c1
Sequence:CCGGCCTGTAGAGATATGATGAGTACTCGAGTACTCATCATATCTCTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153601
LGSN MISSION shRNA Lentiviral Transduction Particles
lengsin, lens protein with glutamine synthetase domain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-597s1c1
Sequence:CCGGCCACATGCTTCAATAGTGATACTCGAGTATCACTATTGAAGCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-566s1c1
Sequence:CCGGCCTAAGGACAATGAGGTGAATCTCGAGATTCACCTCATTGTCCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-1080s1c1
Sequence:CCGGGCCTTGTAATTGAGACTGGATCTCGAGATCCAGTCTCAATTACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153601.1-375s1c1
Sequence:CCGGCGCCTCAACTTTCTGCTAGAACTCGAGTTCTAGCAGAAAGTTGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153601.1-1722s1c1
Sequence:CCGGCCTGTAGAGATATGATGAGTACTCGAGTACTCATCATATCTCTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016571
LGSN MISSION shRNA Bacterial Glycerol Stock
lengsin, lens protein with glutamine synthetase domain
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-284s1c1
Sequence:CCGGCGCCTCCAGTTTGTACGATTTCTCGAGAAATCGTACAAACTGGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-1136s1c1
Sequence:CCGGCGTTATTCCAAGGACAGGAAACTCGAGTTTCCTGTCCTTGGAATAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-394s1c1
Sequence:CCGGCCGAGGTTATCTTGAAGTGATCTCGAGATCACTTCAAGATAACCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-98s1c1
Sequence:CCGGGCCAACAGCATGAACACATTACTCGAGTAATGTGTTCATGCTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-746s1c1
Sequence:CCGGCCCTTCATGCAGGAACTTGTTCTCGAGAACAAGTTCCTGCATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016571.2-176s21c1
Sequence:CCGGACGGATATGTCCAATTCAAATCTCGAGATTTGAATTGGACATATCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016571.2-463s21c1
Sequence:CCGGTAATAGCGACATAGTCCTAATCTCGAGATTAGGACTATGTCGCTATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016571
LGSN MISSION shRNA shRNA Plasmid DNA
lengsin, lens protein with glutamine synthetase domain
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-284s1c1
Sequence:CCGGCGCCTCCAGTTTGTACGATTTCTCGAGAAATCGTACAAACTGGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-1136s1c1
Sequence:CCGGCGTTATTCCAAGGACAGGAAACTCGAGTTTCCTGTCCTTGGAATAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-394s1c1
Sequence:CCGGCCGAGGTTATCTTGAAGTGATCTCGAGATCACTTCAAGATAACCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-98s1c1
Sequence:CCGGGCCAACAGCATGAACACATTACTCGAGTAATGTGTTCATGCTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-746s1c1
Sequence:CCGGCCCTTCATGCAGGAACTTGTTCTCGAGAACAAGTTCCTGCATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016571.2-176s21c1
Sequence:CCGGACGGATATGTCCAATTCAAATCTCGAGATTTGAATTGGACATATCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016571.2-463s21c1
Sequence:CCGGTAATAGCGACATAGTCCTAATCTCGAGATTAGGACTATGTCGCTATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016571
LGSN MISSION shRNA Lentiviral Transduction Particles
lengsin, lens protein with glutamine synthetase domain
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-284s1c1
Sequence:CCGGCGCCTCCAGTTTGTACGATTTCTCGAGAAATCGTACAAACTGGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-1136s1c1
Sequence:CCGGCGTTATTCCAAGGACAGGAAACTCGAGTTTCCTGTCCTTGGAATAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-394s1c1
Sequence:CCGGCCGAGGTTATCTTGAAGTGATCTCGAGATCACTTCAAGATAACCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-98s1c1
Sequence:CCGGGCCAACAGCATGAACACATTACTCGAGTAATGTGTTCATGCTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016571.1-746s1c1
Sequence:CCGGCCCTTCATGCAGGAACTTGTTCTCGAGAACAAGTTCCTGCATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016571.2-176s21c1
Sequence:CCGGACGGATATGTCCAATTCAAATCTCGAGATTTGAATTGGACATATCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016571.2-463s21c1
Sequence:CCGGTAATAGCGACATAGTCCTAATCTCGAGATTAGGACTATGTCGCTATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)