EMAIL THIS PAGE TO A FRIEND

LHB

luteinizing hormone beta polypeptide

60 Gene Product Result for
Synonyms: CGB4 LSH-B hLHB
UniProtKB ID: P01229, Q9UDI0
Gene ID:
Human(3972) Summary: This gene is a member of the glycoprotein hormone beta chain family and encodes the beta subunit of luteinizing hormone (LH). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. LH is expressed in the pituitary gland and promotes spermatogenesis and ovulation by stimulating the testes and ovaries to synthesize steroids. The genes for the beta chains of chorionic gonadotropin and for luteinizing hormone are contiguous on chromosome 19q13.3. Mutations in this gene are associated with hypogonadism which is characterized by infertility and pseudohermaphroditism. [provided by RefSeq, Jul 2008]
Mouse(16866) luteinizing hormone beta
Rat(25329) luteinizing hormone beta
Zebrafish(402917) luteinizing hormone, beta polypeptide
Horse(100054774) luteinizing hormone beta polypeptide
cow(280839) luteinizing hormone beta polypeptide
cow(786429) lutropin subunit beta-like
domestic cat(493833) luteinizing hormone beta polypeptide
dog(403959) luteinizing hormone beta polypeptide
sheep(443395) luteinizing hormone beta polypeptide
Domestic Rabbit(100009427) luteinizing hormone beta polypeptide
domestic guinea pig(100379534) luteinizing hormone beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0709 Human LHB / Lutropin Subunit Beta ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008497 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008497 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008497 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000894 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000894 Rosetta Predictions human pricing
NM_001033975 Rosetta Predictions rat pricing
NM_012858 Rosetta Predictions rat pricing
NM_008497 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030703 predicted 271
2 SASI_Hs01_00030704 predicted 229
3 SASI_Hs01_00030706 predicted 69
4 SASI_Hs01_00030711 predicted 418
5 SASI_Hs01_00030707 predicted 108
6 SASI_Hs01_00030709 predicted 317
7 SASI_Hs01_00030710 predicted 303
8 SASI_Hs01_00030705 predicted 421
9 SASI_Hs01_00030708 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071144 predicted 276
2 SASI_Rn01_00071145 predicted 259
3 SASI_Rn01_00071146 predicted 286
4 SASI_Rn01_00071147 predicted 317
5 SASI_Rn01_00071148 predicted 267
6 SASI_Rn01_00071150 predicted 218
7 SASI_Rn01_00071151 predicted 519
8 SASI_Rn01_00071152 predicted 464
9 SASI_Rn01_00071153 predicted 468
10 SASI_Rn02_00203862 predicted 509
11 SASI_Rn01_00071149 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118896 predicted 238
2 SASI_Rn01_00118897 predicted 227
3 SASI_Rn01_00118898 predicted 245
4 SASI_Rn01_00118899 predicted 271
5 SASI_Rn01_00118900 predicted 231
6 SASI_Rn01_00118902 predicted 176
7 SASI_Rn01_00118903 predicted 479
8 SASI_Rn01_00118904 predicted 422
9 SASI_Rn01_00118905 predicted 429
10 SASI_Rn02_00260343 predicted 465
11 SASI_Rn01_00118901 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008497 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134820 predicted 241
2 SASI_Mm01_00134821 predicted 201
3 SASI_Mm01_00134822 predicted 242
4 SASI_Mm01_00134823 predicted 239
5 SASI_Mm01_00134824 predicted 195
6 SASI_Mm01_00134825 predicted 237
7 SASI_Mm01_00134826 predicted 203
8 SASI_Mm01_00134827 predicted 220
9 SASI_Mm01_00134828 predicted 176
10 SASI_Mm01_00134829 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008497
LHB MISSION shRNA Bacterial Glycerol Stock
luteinizing hormone beta polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-112s1c1
Sequence:CCGGGCAGAGAATGAGTTCTGCCCACTCGAGTGGGCAGAACTCATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-138s1c1
Sequence:CCGGCATCACCTTCACCACCAGCATCTCGAGATGCTGGTGGTGAAGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-114s1c1
Sequence:CCGGAGAGAATGAGTTCTGCCCAGTCTCGAGACTGGGCAGAACTCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-126s1c1
Sequence:CCGGCTGCCCAGTCTGCATCACCTTCTCGAGAAGGTGATGCAGACTGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-172s1c1
Sequence:CCGGTGTCCTAGCATGGTCCGAGTACTCGAGTACTCGGACCATGCTAGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008497
LHB MISSION shRNA shRNA Plasmid DNA
luteinizing hormone beta polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-112s1c1
Sequence:CCGGGCAGAGAATGAGTTCTGCCCACTCGAGTGGGCAGAACTCATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-138s1c1
Sequence:CCGGCATCACCTTCACCACCAGCATCTCGAGATGCTGGTGGTGAAGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-114s1c1
Sequence:CCGGAGAGAATGAGTTCTGCCCAGTCTCGAGACTGGGCAGAACTCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-126s1c1
Sequence:CCGGCTGCCCAGTCTGCATCACCTTCTCGAGAAGGTGATGCAGACTGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-172s1c1
Sequence:CCGGTGTCCTAGCATGGTCCGAGTACTCGAGTACTCGGACCATGCTAGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008497
LHB MISSION shRNA Lentiviral Transduction Particles
luteinizing hormone beta polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-112s1c1
Sequence:CCGGGCAGAGAATGAGTTCTGCCCACTCGAGTGGGCAGAACTCATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-138s1c1
Sequence:CCGGCATCACCTTCACCACCAGCATCTCGAGATGCTGGTGGTGAAGGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-114s1c1
Sequence:CCGGAGAGAATGAGTTCTGCCCAGTCTCGAGACTGGGCAGAACTCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-126s1c1
Sequence:CCGGCTGCCCAGTCTGCATCACCTTCTCGAGAAGGTGATGCAGACTGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008497.1-172s1c1
Sequence:CCGGTGTCCTAGCATGGTCCGAGTACTCGAGTACTCGGACCATGCTAGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000894
LHB MISSION shRNA Bacterial Glycerol Stock
luteinizing hormone beta polypeptide
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-311s1c1
Sequence:CCGGCCTTCCCTGTGGCTCTCAGCTCTCGAGAGCTGAGAGCCACAGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-100s1c1
Sequence:CCGGCCCATCAATGCCATCCTGGCTCTCGAGAGCCAGGATGGCATTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-159s1c1
Sequence:CCGGCACCACCATCTGTGCCGGCTACTCGAGTAGCCGGCACAGATGGTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-255s1c1
Sequence:CCGGGCGCTTCGAGTCCATCCGGCTCTCGAGAGCCGGATGGACTCGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-138s1c1
Sequence:CCGGCCCAGTGTGCATCACCGTCAACTCGAGTTGACGGTGATGCACACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000894
LHB MISSION shRNA shRNA Plasmid DNA
luteinizing hormone beta polypeptide
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-311s1c1
Sequence:CCGGCCTTCCCTGTGGCTCTCAGCTCTCGAGAGCTGAGAGCCACAGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-100s1c1
Sequence:CCGGCCCATCAATGCCATCCTGGCTCTCGAGAGCCAGGATGGCATTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-159s1c1
Sequence:CCGGCACCACCATCTGTGCCGGCTACTCGAGTAGCCGGCACAGATGGTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-255s1c1
Sequence:CCGGGCGCTTCGAGTCCATCCGGCTCTCGAGAGCCGGATGGACTCGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-138s1c1
Sequence:CCGGCCCAGTGTGCATCACCGTCAACTCGAGTTGACGGTGATGCACACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000894
LHB MISSION shRNA Lentiviral Transduction Particles
luteinizing hormone beta polypeptide
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-311s1c1
Sequence:CCGGCCTTCCCTGTGGCTCTCAGCTCTCGAGAGCTGAGAGCCACAGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-100s1c1
Sequence:CCGGCCCATCAATGCCATCCTGGCTCTCGAGAGCCAGGATGGCATTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-159s1c1
Sequence:CCGGCACCACCATCTGTGCCGGCTACTCGAGTAGCCGGCACAGATGGTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-255s1c1
Sequence:CCGGGCGCTTCGAGTCCATCCGGCTCTCGAGAGCCGGATGGACTCGAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000894.2-138s1c1
Sequence:CCGGCCCAGTGTGCATCACCGTCAACTCGAGTTGACGGTGATGCACACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)