EMAIL THIS PAGE TO A FRIEND

LHCGR

luteinizing hormone/choriogonadotropin receptor

56 Gene Product Result for
Synonyms: HHG LCGR LGR2 LH/CG-R LH/CGR LHR LHRHR LSH-R ULG5
UniProtKB ID: P22888, Q14751, Q15996, Q9UEW9
Gene ID:
Human(3973) Summary: This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
Mouse(16867) luteinizing hormone/choriogonadotropin receptor
Rat(25477) luteinizing hormone/choriogonadotropin receptor
Zebrafish(402920) luteinizing hormone/choriogonadotropin receptor
cow(281900) luteinizing hormone/choriogonadotropin receptor
Horse(100034043) luteinizing hormone/choriogonadotropin receptor
domestic cat(101088154) luteinizing hormone/choriogonadotropin receptor
dog(481365) luteinizing hormone/choriogonadotropin receptor
chicken(395776) luteinizing hormone/choriogonadotropin receptor
domestic guinea pig(100731114) luteinizing hormone/choriogonadotropin receptor
naked mole-rat(101718960) luteinizing hormone/choriogonadotropin receptor
sheep(101113228) luteinizing hormone/choriogonadotropin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000233 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000233 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000233 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081971 MISSION® esiRNA esiRNA human LHCGR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000233 Rosetta Predictions human pricing
NM_012978 Rosetta Predictions rat pricing
NM_013582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302142 predicted 641
2 SASI_Hs01_00066448 predicted 1394
3 SASI_Hs01_00066449 predicted 630
4 SASI_Hs01_00066450 predicted 578
5 SASI_Hs01_00066451 predicted 1705
6 SASI_Hs01_00066452 predicted 1906
7 SASI_Hs01_00066453 predicted 1003
8 SASI_Hs01_00066455 predicted 1887
9 SASI_Hs01_00066456 predicted 1291
10 SASI_Hs02_00302143 predicted 391
11 SASI_Hs01_00066447 predicted 1802
12 SASI_Hs01_00066454 predicted 1683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085115 predicted 239
2 SASI_Rn01_00085116 predicted 1112
3 SASI_Rn01_00085117 predicted 1696
4 SASI_Rn01_00085118 predicted 224
5 SASI_Rn02_00260581 predicted 644
6 SASI_Rn01_00085119 predicted 1146
7 SASI_Rn01_00085121 predicted 505
8 SASI_Rn01_00085122 predicted 2236
9 SASI_Rn01_00085123 predicted 1627
10 SASI_Rn01_00085124 predicted 2102
11 SASI_Rn01_00085120 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103696 predicted 934
2 SASI_Mm01_00103697 predicted 1070
3 SASI_Mm01_00103698 predicted 473
4 SASI_Mm01_00103699 predicted 1100
5 SASI_Mm01_00103700 predicted 587
6 SASI_Mm01_00103701 predicted 2196
7 SASI_Mm01_00103703 predicted 938
8 SASI_Mm01_00103704 predicted 1372
9 SASI_Mm01_00103705 predicted 1581
10 SASI_Mm02_00322321 predicted 372
11 SASI_Mm01_00103702 predicted 1658
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013582
LHCGR MISSION shRNA Bacterial Glycerol Stock
luteinizing hormone/choriogonadotropin receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1363s1c1
Sequence:CCGGCCAGTGAACTTTCTGTCTATACTCGAGTATAGACAGAAAGTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1874s1c1
Sequence:CCGGCCCATTTCTGTACGCAGTGTTCTCGAGAACACTGCGTACAGAAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-305s1c1
Sequence:CCGGCCTCCTCAATCTGTCTGAAATCTCGAGATTTCAGACAGATTGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1897s1c1
Sequence:CCGGCGAAGGCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGCCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-934s1c1
Sequence:CCGGGCACAGTTAGAGAAGCGAATACTCGAGTATTCGCTTCTCTAACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013582
LHCGR MISSION shRNA shRNA Plasmid DNA
luteinizing hormone/choriogonadotropin receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1363s1c1
Sequence:CCGGCCAGTGAACTTTCTGTCTATACTCGAGTATAGACAGAAAGTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1874s1c1
Sequence:CCGGCCCATTTCTGTACGCAGTGTTCTCGAGAACACTGCGTACAGAAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-305s1c1
Sequence:CCGGCCTCCTCAATCTGTCTGAAATCTCGAGATTTCAGACAGATTGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1897s1c1
Sequence:CCGGCGAAGGCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGCCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-934s1c1
Sequence:CCGGGCACAGTTAGAGAAGCGAATACTCGAGTATTCGCTTCTCTAACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013582
LHCGR MISSION shRNA Lentiviral Transduction Particles
luteinizing hormone/choriogonadotropin receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1363s1c1
Sequence:CCGGCCAGTGAACTTTCTGTCTATACTCGAGTATAGACAGAAAGTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1874s1c1
Sequence:CCGGCCCATTTCTGTACGCAGTGTTCTCGAGAACACTGCGTACAGAAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-305s1c1
Sequence:CCGGCCTCCTCAATCTGTCTGAAATCTCGAGATTTCAGACAGATTGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-1897s1c1
Sequence:CCGGCGAAGGCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGCCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013582.1-934s1c1
Sequence:CCGGGCACAGTTAGAGAAGCGAATACTCGAGTATTCGCTTCTCTAACTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000233
LHCGR MISSION shRNA Bacterial Glycerol Stock
luteinizing hormone/choriogonadotropin receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-1950s1c1
Sequence:CCGGGCTGAACTTTATAGAAGGAAACTCGAGTTTCCTTCTATAAAGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-1439s1c1
Sequence:CCGGGCTGCGATTAAGACATGCCATCTCGAGATGGCATGTCTTAATCGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-296s1c1
Sequence:CCGGCCTCCTCAATTTGTCTGAAATCTCGAGATTTCAGACAAATTGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000233.1-2710s1c1
Sequence:CCGGCCACAGAAAGTTCTATCTGTTCTCGAGAACAGATAGAACTTTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-408s21c1
Sequence:CCGGACATTGAGCCCGGAGCATTTACTCGAGTAAATGCTCCGGGCTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1334s21c1
Sequence:CCGGACCAAGGGCCAGTACTATAACCTCGAGGTTATAGTACTGGCCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000233.3-2355s21c1
Sequence:CCGGTCATTGTTACATGGCATAAATCTCGAGATTTATGCCATGTAACAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1632s21c1
Sequence:CCGGCCACTCTCTCACAAGTCTATACTCGAGTATAGACTTGTGAGAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1160s21c1
Sequence:CCGGGTCCTGATTTGGCTGATTAATCTCGAGATTAATCAGCCAAATCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000233
LHCGR MISSION shRNA shRNA Plasmid DNA
luteinizing hormone/choriogonadotropin receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-1950s1c1
Sequence:CCGGGCTGAACTTTATAGAAGGAAACTCGAGTTTCCTTCTATAAAGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-1439s1c1
Sequence:CCGGGCTGCGATTAAGACATGCCATCTCGAGATGGCATGTCTTAATCGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-296s1c1
Sequence:CCGGCCTCCTCAATTTGTCTGAAATCTCGAGATTTCAGACAAATTGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000233.1-2710s1c1
Sequence:CCGGCCACAGAAAGTTCTATCTGTTCTCGAGAACAGATAGAACTTTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-408s21c1
Sequence:CCGGACATTGAGCCCGGAGCATTTACTCGAGTAAATGCTCCGGGCTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1334s21c1
Sequence:CCGGACCAAGGGCCAGTACTATAACCTCGAGGTTATAGTACTGGCCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000233.3-2355s21c1
Sequence:CCGGTCATTGTTACATGGCATAAATCTCGAGATTTATGCCATGTAACAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1632s21c1
Sequence:CCGGCCACTCTCTCACAAGTCTATACTCGAGTATAGACTTGTGAGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1160s21c1
Sequence:CCGGGTCCTGATTTGGCTGATTAATCTCGAGATTAATCAGCCAAATCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000233
LHCGR MISSION shRNA Lentiviral Transduction Particles
luteinizing hormone/choriogonadotropin receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-1950s1c1
Sequence:CCGGGCTGAACTTTATAGAAGGAAACTCGAGTTTCCTTCTATAAAGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-1439s1c1
Sequence:CCGGGCTGCGATTAAGACATGCCATCTCGAGATGGCATGTCTTAATCGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000233.1-296s1c1
Sequence:CCGGCCTCCTCAATTTGTCTGAAATCTCGAGATTTCAGACAAATTGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000233.1-2710s1c1
Sequence:CCGGCCACAGAAAGTTCTATCTGTTCTCGAGAACAGATAGAACTTTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-408s21c1
Sequence:CCGGACATTGAGCCCGGAGCATTTACTCGAGTAAATGCTCCGGGCTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1334s21c1
Sequence:CCGGACCAAGGGCCAGTACTATAACCTCGAGGTTATAGTACTGGCCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000233.3-2355s21c1
Sequence:CCGGTCATTGTTACATGGCATAAATCTCGAGATTTATGCCATGTAACAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1632s21c1
Sequence:CCGGCCACTCTCTCACAAGTCTATACTCGAGTATAGACTTGTGAGAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000233.3-1160s21c1
Sequence:CCGGGTCCTGATTTGGCTGATTAATCTCGAGATTAATCAGCCAAATCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)