EMAIL THIS PAGE TO A FRIEND

LHFPL1

lipoma HMGIC fusion partner-like 1

78 Gene Product Result for
UniProtKB ID: Q86WI0, A8K1N1, Q496M9, Q496N0, Q6UXU2
Gene ID:
Human(340596) Summary: This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(237091) lipoma HMGIC fusion partner-like 1
Rat(300286) lipoma HMGIC fusion partner-like 1
dog(492075) lipoma HMGIC fusion partner-like 1
cow(781310) lipoma HMGIC fusion partner-like 1
domestic cat(101096451) lipoma HMGIC fusion partner-like 1
domestic guinea pig(100723083) lipoma HMGIC fusion partner-like 1
naked mole-rat(101703545) lipoma HMGIC fusion partner-like 1
sheep(101109072) lipoma HMGIC fusion partner-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178175 Rosetta Predictions human pricing
NM_181085 Rosetta Predictions rat pricing
NM_178358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158266 predicted 1047
2 SASI_Hs02_00369590 predicted 1265
3 SASI_Hs01_00158267 predicted 737
4 SASI_Hs01_00158269 predicted 785
5 SASI_Hs01_00158270 predicted 975
6 SASI_Hs01_00158271 predicted 789
7 SASI_Hs01_00158272 predicted 747
8 SASI_Hs01_00158273 predicted 1080
9 SASI_Hs01_00158275 predicted 1058
10 SASI_Hs02_00369591 predicted 403
11 SASI_Hs01_00158268 predicted 1100
12 SASI_Hs01_00158274 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082414 predicted 749
2 SASI_Rn01_00082416 predicted 584
3 SASI_Rn01_00082417 predicted 696
4 SASI_Rn01_00082418 predicted 838
5 SASI_Rn01_00082419 predicted 515
6 SASI_Rn01_00082420 predicted 461
7 SASI_Rn01_00082421 predicted 818
8 SASI_Rn01_00082422 predicted 475
9 SASI_Rn01_00082423 predicted 716
10 SASI_Rn02_00269666 predicted 606
11 SASI_Rn01_00082415 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135338 predicted 787
2 SASI_Mm02_00348742 predicted 1039
3 SASI_Mm01_00135339 predicted 1013
4 SASI_Mm01_00135340 predicted 443
5 SASI_Mm01_00135341 predicted 1068
6 SASI_Mm01_00135342 predicted 1054
7 SASI_Mm01_00135343 predicted 1026
8 SASI_Mm01_00135344 predicted 514
9 SASI_Mm01_00135345 predicted 934
10 SASI_Mm01_00135347 predicted 726
11 SASI_Mm01_00135346 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178358
LHFPL1 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178358.3-1432s1c1
Sequence:CCGGGCACATCACAAGAATTACTATCTCGAGATAGTAATTCTTGTGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-788s1c1
Sequence:CCGGCCAATCAATTTCAGTTAGGAACTCGAGTTCCTAACTGAAATTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-728s1c1
Sequence:CCGGGTGCATTATATCCTTTAGGATCTCGAGATCCTAAAGGATATAATGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178358.3-1295s21c1
Sequence:CCGGATGTACTTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-445s1c1
Sequence:CCGGCCAGTATCTTTCAGCACATTCCTCGAGGAATGTGCTGAAAGATACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-777s21c1
Sequence:CCGGCGGGAATGTCTCCAATCAATTCTCGAGAATTGATTGGAGACATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-718s21c1
Sequence:CCGGAGCGCAGGCTGTGCATTATATCTCGAGATATAATGCACAGCCTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-385s21c1
Sequence:CCGGGTGGCCAGTTCTACCAGTTACCTCGAGGTAACTGGTAGAACTGGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-813s21c1
Sequence:CCGGTAGACTCGGCTGGGCCTATTACTCGAGTAATAGGCCCAGCCGAGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178358
LHFPL1 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178358.3-1432s1c1
Sequence:CCGGGCACATCACAAGAATTACTATCTCGAGATAGTAATTCTTGTGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-788s1c1
Sequence:CCGGCCAATCAATTTCAGTTAGGAACTCGAGTTCCTAACTGAAATTGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-728s1c1
Sequence:CCGGGTGCATTATATCCTTTAGGATCTCGAGATCCTAAAGGATATAATGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178358.3-1295s21c1
Sequence:CCGGATGTACTTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-445s1c1
Sequence:CCGGCCAGTATCTTTCAGCACATTCCTCGAGGAATGTGCTGAAAGATACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-777s21c1
Sequence:CCGGCGGGAATGTCTCCAATCAATTCTCGAGAATTGATTGGAGACATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-718s21c1
Sequence:CCGGAGCGCAGGCTGTGCATTATATCTCGAGATATAATGCACAGCCTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-385s21c1
Sequence:CCGGGTGGCCAGTTCTACCAGTTACCTCGAGGTAACTGGTAGAACTGGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-813s21c1
Sequence:CCGGTAGACTCGGCTGGGCCTATTACTCGAGTAATAGGCCCAGCCGAGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178358
LHFPL1 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200825    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178358.3-1432s1c1
Sequence:CCGGGCACATCACAAGAATTACTATCTCGAGATAGTAATTCTTGTGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-788s1c1
Sequence:CCGGCCAATCAATTTCAGTTAGGAACTCGAGTTCCTAACTGAAATTGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-728s1c1
Sequence:CCGGGTGCATTATATCCTTTAGGATCTCGAGATCCTAAAGGATATAATGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178358.3-1295s21c1
Sequence:CCGGATGTACTTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178358.3-445s1c1
Sequence:CCGGCCAGTATCTTTCAGCACATTCCTCGAGGAATGTGCTGAAAGATACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-777s21c1
Sequence:CCGGCGGGAATGTCTCCAATCAATTCTCGAGAATTGATTGGAGACATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-718s21c1
Sequence:CCGGAGCGCAGGCTGTGCATTATATCTCGAGATATAATGCACAGCCTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-385s21c1
Sequence:CCGGGTGGCCAGTTCTACCAGTTACCTCGAGGTAACTGGTAGAACTGGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178358.3-813s21c1
Sequence:CCGGTAGACTCGGCTGGGCCTATTACTCGAGTAATAGGCCCAGCCGAGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178175
LHFPL1 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178175.2-1265s1c1
Sequence:CCGGCATCAGTTCATTCCCAAGTATCTCGAGATACTTGGGAATGAACTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-662s1c1
Sequence:CCGGGATGGAATAGCCCGGAGATAACTCGAGTTATCTCCGGGCTATTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-321s1c1
Sequence:CCGGCTTCCTACCTTACTGGCTCTTCTCGAGAAGAGCCAGTAAGGTAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178175.2-360s1c1
Sequence:CCGGGCCAGTGTCATTCAGCACATTCTCGAGAATGTGCTGAATGACACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178175.2-1256s1c1
Sequence:CCGGCACACAGTTCATCAGTTCATTCTCGAGAATGAACTGATGAACTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-877s1c1
Sequence:CCGGGAGCTTGACCATTGCCTCAAACTCGAGTTTGAGGCAATGGTCAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-671s1c1
Sequence:CCGGGCCCGGAGATAATGCAAACATCTCGAGATGTTTGCATTATCTCCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178175.2-1095s1c1
Sequence:CCGGGAGGAAACATTCTCAGACATTCTCGAGAATGTCTGAGAATGTTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178175.3-1361s21c1
Sequence:CCGGCAGTTCATTCCCAAGTATTTACTCGAGTAAATACTTGGGAATGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178175.3-1053s21c1
Sequence:CCGGGTACTAAGGATTAGGCCATTTCTCGAGAAATGGCCTAATCCTTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178175
LHFPL1 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178175.2-1265s1c1
Sequence:CCGGCATCAGTTCATTCCCAAGTATCTCGAGATACTTGGGAATGAACTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-662s1c1
Sequence:CCGGGATGGAATAGCCCGGAGATAACTCGAGTTATCTCCGGGCTATTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-321s1c1
Sequence:CCGGCTTCCTACCTTACTGGCTCTTCTCGAGAAGAGCCAGTAAGGTAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178175.2-360s1c1
Sequence:CCGGGCCAGTGTCATTCAGCACATTCTCGAGAATGTGCTGAATGACACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178175.2-1256s1c1
Sequence:CCGGCACACAGTTCATCAGTTCATTCTCGAGAATGAACTGATGAACTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-877s1c1
Sequence:CCGGGAGCTTGACCATTGCCTCAAACTCGAGTTTGAGGCAATGGTCAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-671s1c1
Sequence:CCGGGCCCGGAGATAATGCAAACATCTCGAGATGTTTGCATTATCTCCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178175.2-1095s1c1
Sequence:CCGGGAGGAAACATTCTCAGACATTCTCGAGAATGTCTGAGAATGTTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178175.3-1361s21c1
Sequence:CCGGCAGTTCATTCCCAAGTATTTACTCGAGTAAATACTTGGGAATGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178175.3-1053s21c1
Sequence:CCGGGTACTAAGGATTAGGCCATTTCTCGAGAAATGGCCTAATCCTTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178175
LHFPL1 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178175.2-1265s1c1
Sequence:CCGGCATCAGTTCATTCCCAAGTATCTCGAGATACTTGGGAATGAACTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-662s1c1
Sequence:CCGGGATGGAATAGCCCGGAGATAACTCGAGTTATCTCCGGGCTATTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-321s1c1
Sequence:CCGGCTTCCTACCTTACTGGCTCTTCTCGAGAAGAGCCAGTAAGGTAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178175.2-360s1c1
Sequence:CCGGGCCAGTGTCATTCAGCACATTCTCGAGAATGTGCTGAATGACACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178175.2-1256s1c1
Sequence:CCGGCACACAGTTCATCAGTTCATTCTCGAGAATGAACTGATGAACTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-877s1c1
Sequence:CCGGGAGCTTGACCATTGCCTCAAACTCGAGTTTGAGGCAATGGTCAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178175.2-671s1c1
Sequence:CCGGGCCCGGAGATAATGCAAACATCTCGAGATGTTTGCATTATCTCCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178175.2-1095s1c1
Sequence:CCGGGAGGAAACATTCTCAGACATTCTCGAGAATGTCTGAGAATGTTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178175.3-1361s21c1
Sequence:CCGGCAGTTCATTCCCAAGTATTTACTCGAGTAAATACTTGGGAATGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178175.3-1053s21c1
Sequence:CCGGGTACTAAGGATTAGGCCATTTCTCGAGAAATGGCCTAATCCTTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)