EMAIL THIS PAGE TO A FRIEND

LHFPL2

lipoma HMGIC fusion partner-like 2

92 Gene Product Result for
UniProtKB ID: Q6ZUX7, B2RMQ6, Q7Z5P0, Q92605
Gene ID:
Human(10184) Summary: This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(218454) lipoma HMGIC fusion partner-like 2
Rat(294643) lipoma HMGIC fusion partner-like 2
sheep(101113334) lipoma HMGIC fusion partner-like 2
domestic guinea pig(100718648) lipoma HMGIC fusion partner-like 2
chicken(416369) lipoma HMGIC fusion partner-like 2
domestic cat(101081115) lipoma HMGIC fusion partner-like 2
cow(616131) lipoma HMGIC fusion partner-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005779 Rosetta Predictions human pricing
NM_001106402 Rosetta Predictions rat pricing
NM_172589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140437 predicted 1644
2 SASI_Hs01_00140438 predicted 1543
3 SASI_Hs01_00140439 predicted 1442
4 SASI_Hs01_00140441 predicted 1178
5 SASI_Hs02_00340269 predicted 1267
6 SASI_Hs01_00140442 predicted 1157
7 SASI_Hs01_00140443 predicted 1170
8 SASI_Hs01_00140444 predicted 1092
9 SASI_Hs01_00140445 predicted 1405
10 SASI_Hs01_00140446 predicted 1112
11 SASI_Hs01_00140440 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218608 predicted 1405
2 SASI_Rn02_00218609 predicted 557
3 SASI_Rn02_00218610 predicted 1172
4 SASI_Rn02_00218611 predicted 1107
5 SASI_Rn02_00218612 predicted 897
6 SASI_Rn02_00218613 predicted 1076
7 SASI_Rn02_00218614 predicted 1288
8 SASI_Rn02_00218615 predicted 1085
9 SASI_Rn02_00218616 predicted 747
10 SASI_Rn02_00218617 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344271 predicted 838
2 SASI_Mm01_00144294 predicted 1401
3 SASI_Mm01_00144295 predicted 1512
4 SASI_Mm02_00344272 predicted 1025
5 SASI_Mm01_00144296 predicted 672
6 SASI_Mm01_00144297 predicted 1404
7 SASI_Mm01_00144299 predicted 1389
8 SASI_Mm01_00144300 predicted 416
9 SASI_Mm01_00144301 predicted 1486
10 SASI_Mm01_00144302 predicted 1357
11 SASI_Mm01_00144298 predicted 1306
12 SASI_Mm01_00144303 predicted 1529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005779
VALIDATED
LHFPL2 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005779.2-1541s21c1
Sequence:CCGGGGTCTGCAGTGCACATTATAACTCGAGTTATAATGTGCACTGCAGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005779.2-1296s21c1
Sequence:CCGGTTGCAACCTCTAGTGACAAAGCTCGAGCTTTGTCACTAGAGGTTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005779.2-1182s21c1
Sequence:CCGGATTATGCATCTGCCTACAAACCTCGAGGTTTGTAGGCAGATGCATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-492s1c1
Sequence:CCGGGCAAGGAATTGCAGGTCTATTCTCGAGAATAGACCTGCAATTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005779.1-441s1c1
Sequence:CCGGGTGTGTACAGAGCATCATGAACTCGAGTTCATGATGCTCTGTACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-506s1c1
Sequence:CCGGGTCTATTCCTTATCCTCGGTTCTCGAGAACCGAGGATAAGGAATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-1031s1c1
Sequence:CCGGCCAGGTTCAATGAAGGATAATCTCGAGATTATCCTTCATTGAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005779.1-1030s1c1
Sequence:CCGGCCCAGGTTCAATGAAGGATAACTCGAGTTATCCTTCATTGAACCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005779
VALIDATED
LHFPL2 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005779.2-1541s21c1
Sequence:CCGGGGTCTGCAGTGCACATTATAACTCGAGTTATAATGTGCACTGCAGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005779.2-1296s21c1
Sequence:CCGGTTGCAACCTCTAGTGACAAAGCTCGAGCTTTGTCACTAGAGGTTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005779.2-1182s21c1
Sequence:CCGGATTATGCATCTGCCTACAAACCTCGAGGTTTGTAGGCAGATGCATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-492s1c1
Sequence:CCGGGCAAGGAATTGCAGGTCTATTCTCGAGAATAGACCTGCAATTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005779.1-441s1c1
Sequence:CCGGGTGTGTACAGAGCATCATGAACTCGAGTTCATGATGCTCTGTACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-506s1c1
Sequence:CCGGGTCTATTCCTTATCCTCGGTTCTCGAGAACCGAGGATAAGGAATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-1031s1c1
Sequence:CCGGCCAGGTTCAATGAAGGATAATCTCGAGATTATCCTTCATTGAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005779.1-1030s1c1
Sequence:CCGGCCCAGGTTCAATGAAGGATAACTCGAGTTATCCTTCATTGAACCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005779
VALIDATED
LHFPL2 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005779.2-1541s21c1
Sequence:CCGGGGTCTGCAGTGCACATTATAACTCGAGTTATAATGTGCACTGCAGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005779.2-1296s21c1
Sequence:CCGGTTGCAACCTCTAGTGACAAAGCTCGAGCTTTGTCACTAGAGGTTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005779.2-1182s21c1
Sequence:CCGGATTATGCATCTGCCTACAAACCTCGAGGTTTGTAGGCAGATGCATAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-492s1c1
Sequence:CCGGGCAAGGAATTGCAGGTCTATTCTCGAGAATAGACCTGCAATTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005779.1-441s1c1
Sequence:CCGGGTGTGTACAGAGCATCATGAACTCGAGTTCATGATGCTCTGTACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-506s1c1
Sequence:CCGGGTCTATTCCTTATCCTCGGTTCTCGAGAACCGAGGATAAGGAATAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005779.1-1031s1c1
Sequence:CCGGCCAGGTTCAATGAAGGATAATCTCGAGATTATCCTTCATTGAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005779.1-1030s1c1
Sequence:CCGGCCCAGGTTCAATGAAGGATAACTCGAGTTATCCTTCATTGAACCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172589
LHFPL2 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000124160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-726s1c1
Sequence:CCGGCGTGCAAAGCATCATGAGGAACTCGAGTTCCTCATGATGCTTTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-779s1c1
Sequence:CCGGGAATCGCAGGTCTGTTCCTTACTCGAGTAAGGAACAGACCTGCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-936s1c1
Sequence:CCGGCACCTTTATCTGTGCTGTCTTCTCGAGAAGACAGCACAGATAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172589.1-3749s1c1
Sequence:CCGGCGCTAGAACAATCACTATGTTCTCGAGAACATAGTGATTGTTCTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172589
LHFPL2 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000124160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-726s1c1
Sequence:CCGGCGTGCAAAGCATCATGAGGAACTCGAGTTCCTCATGATGCTTTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-779s1c1
Sequence:CCGGGAATCGCAGGTCTGTTCCTTACTCGAGTAAGGAACAGACCTGCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-936s1c1
Sequence:CCGGCACCTTTATCTGTGCTGTCTTCTCGAGAAGACAGCACAGATAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172589.1-3749s1c1
Sequence:CCGGCGCTAGAACAATCACTATGTTCTCGAGAACATAGTGATTGTTCTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172589
LHFPL2 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000124160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-726s1c1
Sequence:CCGGCGTGCAAAGCATCATGAGGAACTCGAGTTCCTCATGATGCTTTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-779s1c1
Sequence:CCGGGAATCGCAGGTCTGTTCCTTACTCGAGTAAGGAACAGACCTGCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172589.1-936s1c1
Sequence:CCGGCACCTTTATCTGTGCTGTCTTCTCGAGAAGACAGCACAGATAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172589.1-3749s1c1
Sequence:CCGGCGCTAGAACAATCACTATGTTCTCGAGAACATAGTGATTGTTCTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)