EMAIL THIS PAGE TO A FRIEND

LHFPL3

lipoma HMGIC fusion partner-like 3

258 Gene Product Result for
Synonyms: LHFPL4
UniProtKB ID: Q86UP9
Gene ID:
Human(375612) Summary: This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. A partial gene fragment named LHFPL4 corresponds to a portion of the first exon of this gene. [provided by RefSeq, Jul 2008]
Mouse(269629) lipoma HMGIC fusion partner-like 3
Rat(499977) lipoma HMGIC fusion partner-like 3
Zebrafish(445050) lipoma HMGIC fusion partner-like 3
domestic cat(101085191) lipoma HMGIC fusion partner-like 3
cow(520147) lipoma HMGIC fusion partner-like 3
domestic guinea pig(100722815) lipoma HMGIC fusion partner-like 3
naked mole-rat(101718056) lipoma HMGIC fusion partner-like 3
sheep(101121341) lipoma HMGIC fusion partner-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199000 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007131 MISSION® esiRNA esiRNA targeting human LHFPL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199000 Rosetta Predictions human pricing
XM_001062080 Rosetta Predictions rat pricing
XM_575331 Rosetta Predictions rat pricing
NM_001081231 Rosetta Predictions mouse pricing
XM_485569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212641 predicted 863
2 SASI_Hs01_00212642 predicted 855
3 SASI_Hs01_00212643 predicted 493
4 SASI_Hs01_00212644 predicted 936
5 SASI_Hs01_00212645 predicted 868
6 SASI_Hs01_00212646 predicted 1133
7 SASI_Hs01_00212647 predicted 1075
8 SASI_Hs01_00212648 predicted 810
9 SASI_Hs01_00212649 predicted 684
10 SASI_Hs01_00212650 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302327 predicted 996
2 SASI_Rn02_00302328 predicted 890
3 SASI_Rn02_00302329 predicted 842
4 SASI_Rn02_00302330 predicted 1103
5 SASI_Rn02_00302331 predicted 1005
6 SASI_Rn02_00302332 predicted 1089
7 SASI_Rn02_00302333 predicted 895
8 SASI_Rn02_00302334 predicted 796
9 SASI_Rn02_00302335 predicted 946
10 SASI_Rn02_00302336 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403508 predicted 1259
2 SASI_Rn02_00403509 predicted 997
3 SASI_Rn02_00403510 predicted 1122
4 SASI_Rn02_00403511 predicted 1106
5 SASI_Rn02_00403512 predicted 1078
6 SASI_Rn02_00403513 predicted 1052
7 SASI_Rn02_00403514 predicted 1096
8 SASI_Rn02_00403515 predicted 952
9 SASI_Rn02_00403516 predicted 1290
10 SASI_Rn02_00403517 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296464 predicted 742
2 SASI_Mm02_00296465 predicted 887
3 SASI_Mm02_00296466 predicted 880
4 SASI_Mm02_00296467 predicted 843
5 SASI_Mm02_00296468 predicted 635
6 SASI_Mm02_00296469 predicted 855
7 SASI_Mm02_00296470 predicted 796
8 SASI_Mm02_00296471 predicted 894
9 SASI_Mm02_00296472 predicted 798
10 SASI_Mm02_00296473 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219538 predicted 741
2 SASI_Mm01_00219539 predicted 897
3 SASI_Mm01_00219540 predicted 885
4 SASI_Mm01_00219541 predicted 848
5 SASI_Mm01_00219542 predicted 638
6 SASI_Mm01_00219543 predicted 861
7 SASI_Mm01_00219544 predicted 801
8 SASI_Mm01_00219545 predicted 900
9 SASI_Mm01_00219546 predicted 803
10 SASI_Mm01_00219547 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081231
LHFPL3 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-608s21c1
Sequence:CCGGCTGGGATTCAGACGAAGTAAACTCGAGTTTACTTCGTCTGAATCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-256s21c1
Sequence:CCGGTCTGCTTTGCCATCGTCAATGCTCGAGCATTGACGATGGCAAAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-577s21c1
Sequence:CCGGTTGTCCTTGGCTGTATGATTTCTCGAGAAATCATACAGCCAAGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-697s21c1
Sequence:CCGGTGGCTATCATCGGAATCTTAGCTCGAGCTAAGATTCCGATGATAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081231.1-2391s21c1
Sequence:CCGGCATAAGACCGTGCTCATATTTCTCGAGAAATATGAGCACGGTCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081231
LHFPL3 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-608s21c1
Sequence:CCGGCTGGGATTCAGACGAAGTAAACTCGAGTTTACTTCGTCTGAATCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-256s21c1
Sequence:CCGGTCTGCTTTGCCATCGTCAATGCTCGAGCATTGACGATGGCAAAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-577s21c1
Sequence:CCGGTTGTCCTTGGCTGTATGATTTCTCGAGAAATCATACAGCCAAGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-697s21c1
Sequence:CCGGTGGCTATCATCGGAATCTTAGCTCGAGCTAAGATTCCGATGATAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081231.1-2391s21c1
Sequence:CCGGCATAAGACCGTGCTCATATTTCTCGAGAAATATGAGCACGGTCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081231
LHFPL3 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-608s21c1
Sequence:CCGGCTGGGATTCAGACGAAGTAAACTCGAGTTTACTTCGTCTGAATCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-256s21c1
Sequence:CCGGTCTGCTTTGCCATCGTCAATGCTCGAGCATTGACGATGGCAAAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-577s21c1
Sequence:CCGGTTGTCCTTGGCTGTATGATTTCTCGAGAAATCATACAGCCAAGGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081231.1-697s21c1
Sequence:CCGGTGGCTATCATCGGAATCTTAGCTCGAGCTAAGATTCCGATGATAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081231.1-2391s21c1
Sequence:CCGGCATAAGACCGTGCTCATATTTCTCGAGAAATATGAGCACGGTCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199000
LHFPL3 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-1359s1c1
Sequence:CCGGCCGTGACCTTTGGTTCTTCATCTCGAGATGAAGAACCAAAGGTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-190s1c1
Sequence:CCGGCAAGCTGTACCACACCAACTACTCGAGTAGTTGGTGTGGTACAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-577s1c1
Sequence:CCGGCCTTGTGCTTGGCTGTATGATCTCGAGATCATACAGCCAAGCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-780s1c1
Sequence:CCGGCAGAGGAACTGAAGGCAGAAACTCGAGTTTCTGCCTTCAGTTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-193s1c1
Sequence:CCGGGCTGTACCACACCAACTATGTCTCGAGACATAGTTGGTGTGGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-245s1c1
Sequence:CCGGGCCATCTTCACCATCTGCTTTCTCGAGAAAGCAGATGGTGAAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-475s1c1
Sequence:CCGGGCTCATCATTGCCTGCATCATCTCGAGATGATGCAGGCAATGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-930s1c1
Sequence:CCGGCCTGAGAGAGATCAGAGTATACTCGAGTATACTCTGATCTCTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-490s1c1
Sequence:CCGGCATCATTTGCTTTACCCTCTTCTCGAGAAGAGGGTAAAGCAAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-1305s1c1
Sequence:CCGGCGTCATTTATTGAGGAAGCATCTCGAGATGCTTCCTCAATAAATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-689s1c1
Sequence:CCGGGCATACATCCTGGCTATTATTCTCGAGAATAATAGCCAGGATGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199000
LHFPL3 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-1359s1c1
Sequence:CCGGCCGTGACCTTTGGTTCTTCATCTCGAGATGAAGAACCAAAGGTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-190s1c1
Sequence:CCGGCAAGCTGTACCACACCAACTACTCGAGTAGTTGGTGTGGTACAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-577s1c1
Sequence:CCGGCCTTGTGCTTGGCTGTATGATCTCGAGATCATACAGCCAAGCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-780s1c1
Sequence:CCGGCAGAGGAACTGAAGGCAGAAACTCGAGTTTCTGCCTTCAGTTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-193s1c1
Sequence:CCGGGCTGTACCACACCAACTATGTCTCGAGACATAGTTGGTGTGGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-245s1c1
Sequence:CCGGGCCATCTTCACCATCTGCTTTCTCGAGAAAGCAGATGGTGAAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-475s1c1
Sequence:CCGGGCTCATCATTGCCTGCATCATCTCGAGATGATGCAGGCAATGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-930s1c1
Sequence:CCGGCCTGAGAGAGATCAGAGTATACTCGAGTATACTCTGATCTCTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-490s1c1
Sequence:CCGGCATCATTTGCTTTACCCTCTTCTCGAGAAGAGGGTAAAGCAAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-1305s1c1
Sequence:CCGGCGTCATTTATTGAGGAAGCATCTCGAGATGCTTCCTCAATAAATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-689s1c1
Sequence:CCGGGCATACATCCTGGCTATTATTCTCGAGAATAATAGCCAGGATGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199000
LHFPL3 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-1359s1c1
Sequence:CCGGCCGTGACCTTTGGTTCTTCATCTCGAGATGAAGAACCAAAGGTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-190s1c1
Sequence:CCGGCAAGCTGTACCACACCAACTACTCGAGTAGTTGGTGTGGTACAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-577s1c1
Sequence:CCGGCCTTGTGCTTGGCTGTATGATCTCGAGATCATACAGCCAAGCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-780s1c1
Sequence:CCGGCAGAGGAACTGAAGGCAGAAACTCGAGTTTCTGCCTTCAGTTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-193s1c1
Sequence:CCGGGCTGTACCACACCAACTATGTCTCGAGACATAGTTGGTGTGGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-245s1c1
Sequence:CCGGGCCATCTTCACCATCTGCTTTCTCGAGAAAGCAGATGGTGAAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-475s1c1
Sequence:CCGGGCTCATCATTGCCTGCATCATCTCGAGATGATGCAGGCAATGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-930s1c1
Sequence:CCGGCCTGAGAGAGATCAGAGTATACTCGAGTATACTCTGATCTCTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-490s1c1
Sequence:CCGGCATCATTTGCTTTACCCTCTTCTCGAGAAGAGGGTAAAGCAAATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199000.1-1305s1c1
Sequence:CCGGCGTCATTTATTGAGGAAGCATCTCGAGATGCTTCCTCAATAAATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199000.1-689s1c1
Sequence:CCGGGCATACATCCTGGCTATTATTCTCGAGAATAATAGCCAGGATGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)