EMAIL THIS PAGE TO A FRIEND

LHFPL4

lipoma HMGIC fusion partner-like 4

49 Gene Product Result for
UniProtKB ID: Q7Z7J7, A6NH76, Q29RV7
Gene ID:
Human(375323) Summary: This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. [provided by RefSeq, Jul 2008]
Mouse(269788) lipoma HMGIC fusion partner-like protein 4
Rat(353230) lipoma HMGIC fusion partner-like 4
chicken(770959) lipoma HMGIC fusion partner-like 4
dog(484669) lipoma HMGIC fusion partner-like 4
cow(540541) lipoma HMGIC fusion partner-like 4
domestic cat(101090595) lipoma HMGIC fusion partner-like 4
sheep(101105445) lipoma HMGIC fusion partner-like 4
domestic guinea pig(100720214) lipoma HMGIC fusion partner-like 4
naked mole-rat(101723996) lipoma HMGIC fusion partner-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198560 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009361 MISSION® esiRNA esiRNA targeting human LHFPL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198560 Rosetta Predictions human pricing
NM_181387 Rosetta Predictions rat pricing
NM_177763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372175 predicted 908
2 SASI_Hs02_00372176 predicted 707
3 SASI_Hs02_00372177 predicted 1040
4 SASI_Hs01_00086462 predicted 1092
5 SASI_Hs02_00372178 predicted 1229
6 SASI_Hs02_00372179 predicted 823
7 SASI_Hs02_00372180 predicted 1248
8 SASI_Hs01_00086463 predicted 638
9 SASI_Hs02_00372181 predicted 1234
10 SASI_Hs01_00086464 predicted 1128
11 SASI_Hs01_00086460 predicted 1221
12 SASI_Hs01_00086461 predicted 1042
13 SASI_Hs01_00086465 predicted 1096
14 SASI_Hs01_00086466 predicted 601
15 SASI_Hs01_00086467 predicted 556
16 SASI_Hs01_00086468 predicted 1084
17 SASI_Hs01_00086469 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181387 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269736 predicted 486
2 SASI_Rn01_00052888 predicted 464
3 SASI_Rn01_00052889 predicted 600
4 SASI_Rn01_00052890 predicted 616
5 SASI_Rn01_00052891 predicted 717
6 SASI_Rn01_00052892 predicted 705
7 SASI_Rn01_00052893 predicted 710
8 SASI_Rn01_00052894 predicted 626
9 SASI_Rn01_00052895 predicted 591
10 SASI_Rn01_00052896 predicted 449
11 SASI_Rn01_00052897 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194118 predicted 1236
2 SASI_Mm01_00194119 predicted 669
3 SASI_Mm01_00194120 predicted 557
4 SASI_Mm01_00194121 predicted 601
5 SASI_Mm01_00194122 predicted 1217
6 SASI_Mm01_00194123 predicted 769
7 SASI_Mm01_00194124 predicted 862
8 SASI_Mm01_00194126 predicted 1411
9 SASI_Mm01_00194127 predicted 1375
10 SASI_Mm02_00348138 predicted 783
11 SASI_Mm01_00194125 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198560
LHFPL4 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198560.2-647s21c1
Sequence:CCGGACGGCTACGGTCTACAAGATCCTCGAGGATCTTGTAGACCGTAGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198560.2-1219s21c1
Sequence:CCGGCAAACCTTGGGAGGGTCTAATCTCGAGATTAGACCCTCCCAAGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-376s1c1
Sequence:CCGGCATCTGCTTCGCCATCATCAACTCGAGTTGATGATGGCGAAGCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198560.1-1116s1c1
Sequence:CCGGGAAGACCCTGATCTCAGACTTCTCGAGAAGTCTGAGATCAGGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-911s1c1
Sequence:CCGGCTCAAGCCGGAGAACAAAGATCTCGAGATCTTTGTTCTCCGGCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-913s1c1
Sequence:CCGGCAAGCCGGAGAACAAAGATTTCTCGAGAAATCTTTGTTCTCCGGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-711s1c1
Sequence:CCGGGCTGCATGATCTTTCCTGATGCTCGAGCATCAGGAAAGATCATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198560.1-1036s1c1
Sequence:CCGGCAGGATCACAGCCCAGTAATTCTCGAGAATTACTGGGCTGTGATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198560
LHFPL4 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198560.2-647s21c1
Sequence:CCGGACGGCTACGGTCTACAAGATCCTCGAGGATCTTGTAGACCGTAGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198560.2-1219s21c1
Sequence:CCGGCAAACCTTGGGAGGGTCTAATCTCGAGATTAGACCCTCCCAAGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-376s1c1
Sequence:CCGGCATCTGCTTCGCCATCATCAACTCGAGTTGATGATGGCGAAGCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198560.1-1116s1c1
Sequence:CCGGGAAGACCCTGATCTCAGACTTCTCGAGAAGTCTGAGATCAGGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-911s1c1
Sequence:CCGGCTCAAGCCGGAGAACAAAGATCTCGAGATCTTTGTTCTCCGGCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-913s1c1
Sequence:CCGGCAAGCCGGAGAACAAAGATTTCTCGAGAAATCTTTGTTCTCCGGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-711s1c1
Sequence:CCGGGCTGCATGATCTTTCCTGATGCTCGAGCATCAGGAAAGATCATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198560.1-1036s1c1
Sequence:CCGGCAGGATCACAGCCCAGTAATTCTCGAGAATTACTGGGCTGTGATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198560
LHFPL4 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198560.2-647s21c1
Sequence:CCGGACGGCTACGGTCTACAAGATCCTCGAGGATCTTGTAGACCGTAGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198560.2-1219s21c1
Sequence:CCGGCAAACCTTGGGAGGGTCTAATCTCGAGATTAGACCCTCCCAAGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-376s1c1
Sequence:CCGGCATCTGCTTCGCCATCATCAACTCGAGTTGATGATGGCGAAGCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198560.1-1116s1c1
Sequence:CCGGGAAGACCCTGATCTCAGACTTCTCGAGAAGTCTGAGATCAGGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-911s1c1
Sequence:CCGGCTCAAGCCGGAGAACAAAGATCTCGAGATCTTTGTTCTCCGGCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-913s1c1
Sequence:CCGGCAAGCCGGAGAACAAAGATTTCTCGAGAAATCTTTGTTCTCCGGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198560.1-711s1c1
Sequence:CCGGGCTGCATGATCTTTCCTGATGCTCGAGCATCAGGAAAGATCATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198560.1-1036s1c1
Sequence:CCGGCAGGATCACAGCCCAGTAATTCTCGAGAATTACTGGGCTGTGATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177763
LHFPL4 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.3-668s1c1
Sequence:CCGGGTCTTGGGCTGTATGATCTTTCTCGAGAAAGATCATACAGCCCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177763.2-1374s1c1
Sequence:CCGGCGCCTAAAGAGACTTACTCAACTCGAGTTGAGTAAGTCTCTTTAGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-893s1c1
Sequence:CCGGGATTTCGTGGGCACTACAGTACTCGAGTACTGTAGTGCCCACGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-538s1c1
Sequence:CCGGCTTCTTCGTGTTGCTTTCCATCTCGAGATGGAAAGCAACACGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-547s1c1
Sequence:CCGGGTTGCTTTCCATGGTGCTGATCTCGAGATCAGCACCATGGAAAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-875s1c1
Sequence:CCGGCTCAAACAGGAGAACAAAGATCTCGAGATCTTTGTTCTCCTGTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-872s1c1
Sequence:CCGGGAGCTCAAACAGGAGAACAAACTCGAGTTTGTTCTCCTGTTTGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177763.2-2746s1c1
Sequence:CCGGCCAGATCCCATCTCCACATTTCTCGAGAAATGTGGAGATGGGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177763
LHFPL4 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.3-668s1c1
Sequence:CCGGGTCTTGGGCTGTATGATCTTTCTCGAGAAAGATCATACAGCCCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177763.2-1374s1c1
Sequence:CCGGCGCCTAAAGAGACTTACTCAACTCGAGTTGAGTAAGTCTCTTTAGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-893s1c1
Sequence:CCGGGATTTCGTGGGCACTACAGTACTCGAGTACTGTAGTGCCCACGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-538s1c1
Sequence:CCGGCTTCTTCGTGTTGCTTTCCATCTCGAGATGGAAAGCAACACGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-547s1c1
Sequence:CCGGGTTGCTTTCCATGGTGCTGATCTCGAGATCAGCACCATGGAAAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-875s1c1
Sequence:CCGGCTCAAACAGGAGAACAAAGATCTCGAGATCTTTGTTCTCCTGTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-872s1c1
Sequence:CCGGGAGCTCAAACAGGAGAACAAACTCGAGTTTGTTCTCCTGTTTGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177763.2-2746s1c1
Sequence:CCGGCCAGATCCCATCTCCACATTTCTCGAGAAATGTGGAGATGGGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177763
LHFPL4 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.3-668s1c1
Sequence:CCGGGTCTTGGGCTGTATGATCTTTCTCGAGAAAGATCATACAGCCCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177763.2-1374s1c1
Sequence:CCGGCGCCTAAAGAGACTTACTCAACTCGAGTTGAGTAAGTCTCTTTAGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-893s1c1
Sequence:CCGGGATTTCGTGGGCACTACAGTACTCGAGTACTGTAGTGCCCACGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-538s1c1
Sequence:CCGGCTTCTTCGTGTTGCTTTCCATCTCGAGATGGAAAGCAACACGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-547s1c1
Sequence:CCGGGTTGCTTTCCATGGTGCTGATCTCGAGATCAGCACCATGGAAAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-875s1c1
Sequence:CCGGCTCAAACAGGAGAACAAAGATCTCGAGATCTTTGTTCTCCTGTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177763.2-872s1c1
Sequence:CCGGGAGCTCAAACAGGAGAACAAACTCGAGTTTGTTCTCCTGTTTGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177763.2-2746s1c1
Sequence:CCGGCCAGATCCCATCTCCACATTTCTCGAGAAATGTGGAGATGGGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)