EMAIL THIS PAGE TO A FRIEND

LHFPL5

lipoma HMGIC fusion partner-like 5

49 Gene Product Result for
Synonyms: DFNB67 TMHS dJ510O8.8
UniProtKB ID: Q8TAF8
Gene ID:
Human(222662) Summary: This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in this gene result in deafness in humans, and a mutation in a similar gene in mice results in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. It is proposed to function in hair bundle morphogenesis. [provided by RefSeq, Jul 2008]
Mouse(328789) lipoma HMGIC fusion partner-like 5
Rat(294303) lipoma HMGIC fusion partner-like 5
chicken(378916) lipoma HMGIC fusion partner-like 5
cow(527838) lipoma HMGIC fusion partner-like 5
domestic cat(101090772) lipoma HMGIC fusion partner-like 5
dog(481761) lipoma HMGIC fusion partner-like 5
domestic guinea pig(100730378) lipoma HMGIC fusion partner-like 5
naked mole-rat(101717172) lipoma HMGIC fusion partner-like 5
sheep(101119339) lipoma HMGIC fusion partner-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182548 Rosetta Predictions human pricing
NM_001013906 Rosetta Predictions rat pricing
NM_026571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043421 predicted 403
2 SASI_Hs01_00043422 predicted 404
3 SASI_Hs01_00043424 predicted 732
4 SASI_Hs01_00043426 predicted 408
5 SASI_Hs01_00043427 predicted 818
6 SASI_Hs01_00043428 predicted 721
7 SASI_Hs01_00043429 predicted 647
8 SASI_Hs02_00370662 predicted 748
9 SASI_Hs02_00370663 predicted 1036
10 SASI_Hs02_00370664 predicted 1034
11 SASI_Hs01_00043420 predicted 714
12 SASI_Hs01_00043423 predicted 1002
13 SASI_Hs01_00043425 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071249 predicted 272
2 SASI_Rn01_00071250 predicted 992
3 SASI_Rn01_00071251 predicted 455
4 SASI_Rn01_00071252 predicted 521
5 SASI_Rn01_00071253 predicted 1123
6 SASI_Rn02_00201191 predicted 784
7 SASI_Rn01_00071254 predicted 1039
8 SASI_Rn01_00071255 predicted 1018
9 SASI_Rn01_00071256 predicted 997
10 SASI_Rn01_00071257 predicted 278
11 SASI_Rn01_00071248 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330518 predicted 453
2 SASI_Mm01_00199589 predicted 695
3 SASI_Mm02_00330519 predicted 983
4 SASI_Mm01_00199591 predicted 905
5 SASI_Mm01_00199590 predicted 639
6 SASI_Mm02_00330520 predicted 597
7 SASI_Mm01_00199592 predicted 314
8 SASI_Mm02_00330521 predicted 733
9 SASI_Mm02_00330522 predicted 809
10 SASI_Mm02_00330523 predicted 550
11 SASI_Mm01_00199587 predicted 442
12 SASI_Mm01_00199588 predicted 623
13 SASI_Mm01_00199593 predicted 727
14 SASI_Mm01_00199594 predicted 447
15 SASI_Mm01_00199595 predicted 905
16 SASI_Mm01_00199596 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026571
LHFPL5 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026571.1-954s1c1
Sequence:CCGGCAATTCTAACAGCTGAAGAAACTCGAGTTTCTTCAGCTGTTAGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026571.1-947s1c1
Sequence:CCGGGCAGCAACAATTCTAACAGCTCTCGAGAGCTGTTAGAATTGTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-630s1c1
Sequence:CCGGCTGTAATACAGCCACGGTCTACTCGAGTAGACCGTGGCTGTATTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-704s1c1
Sequence:CCGGGTCTAGTCTACCCAGATGGTTCTCGAGAACCATCTGGGTAGACTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-617s1c1
Sequence:CCGGGCCTGTTCTTGGTCTGTAATACTCGAGTATTACAGACCAAGAACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026571
LHFPL5 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026571.1-954s1c1
Sequence:CCGGCAATTCTAACAGCTGAAGAAACTCGAGTTTCTTCAGCTGTTAGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026571.1-947s1c1
Sequence:CCGGGCAGCAACAATTCTAACAGCTCTCGAGAGCTGTTAGAATTGTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-630s1c1
Sequence:CCGGCTGTAATACAGCCACGGTCTACTCGAGTAGACCGTGGCTGTATTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-704s1c1
Sequence:CCGGGTCTAGTCTACCCAGATGGTTCTCGAGAACCATCTGGGTAGACTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-617s1c1
Sequence:CCGGGCCTGTTCTTGGTCTGTAATACTCGAGTATTACAGACCAAGAACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026571
LHFPL5 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026571.1-954s1c1
Sequence:CCGGCAATTCTAACAGCTGAAGAAACTCGAGTTTCTTCAGCTGTTAGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026571.1-947s1c1
Sequence:CCGGGCAGCAACAATTCTAACAGCTCTCGAGAGCTGTTAGAATTGTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-630s1c1
Sequence:CCGGCTGTAATACAGCCACGGTCTACTCGAGTAGACCGTGGCTGTATTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-704s1c1
Sequence:CCGGGTCTAGTCTACCCAGATGGTTCTCGAGAACCATCTGGGTAGACTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026571.1-617s1c1
Sequence:CCGGGCCTGTTCTTGGTCTGTAATACTCGAGTATTACAGACCAAGAACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182548
LHFPL5 MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner-like 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-710s1c1
Sequence:CCGGCATCATCTGCTTCAGCCTGTTCTCGAGAACAGGCTGAAGCAGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182548.2-1723s1c1
Sequence:CCGGCCATCAGAACTTGAATCCTTTCTCGAGAAAGGATTCAAGTTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-656s1c1
Sequence:CCGGCTTCAAGACTGCCATGTTCTTCTCGAGAAGAACATGGCAGTCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182548.2-1245s1c1
Sequence:CCGGGTGACCCACTTCAAAGATATTCTCGAGAATATCTTTGAAGTGGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-655s1c1
Sequence:CCGGCCTTCAAGACTGCCATGTTCTCTCGAGAGAACATGGCAGTCTTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182548
LHFPL5 MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner-like 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-710s1c1
Sequence:CCGGCATCATCTGCTTCAGCCTGTTCTCGAGAACAGGCTGAAGCAGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182548.2-1723s1c1
Sequence:CCGGCCATCAGAACTTGAATCCTTTCTCGAGAAAGGATTCAAGTTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-656s1c1
Sequence:CCGGCTTCAAGACTGCCATGTTCTTCTCGAGAAGAACATGGCAGTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182548.2-1245s1c1
Sequence:CCGGGTGACCCACTTCAAAGATATTCTCGAGAATATCTTTGAAGTGGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-655s1c1
Sequence:CCGGCCTTCAAGACTGCCATGTTCTCTCGAGAGAACATGGCAGTCTTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182548
LHFPL5 MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner-like 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-710s1c1
Sequence:CCGGCATCATCTGCTTCAGCCTGTTCTCGAGAACAGGCTGAAGCAGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182548.2-1723s1c1
Sequence:CCGGCCATCAGAACTTGAATCCTTTCTCGAGAAAGGATTCAAGTTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-656s1c1
Sequence:CCGGCTTCAAGACTGCCATGTTCTTCTCGAGAAGAACATGGCAGTCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182548.2-1245s1c1
Sequence:CCGGGTGACCCACTTCAAAGATATTCTCGAGAATATCTTTGAAGTGGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182548.2-655s1c1
Sequence:CCGGCCTTCAAGACTGCCATGTTCTCTCGAGAGAACATGGCAGTCTTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)