EMAIL THIS PAGE TO A FRIEND

LHPP

phospholysine phosphohistidine inorganic pyrophosphate phosphatase

68 Gene Product Result for
Synonyms: HDHD2B
UniProtKB ID: Q9H008, B3KP20, Q2TBE9, Q5VUV9, Q5VUW0
Gene ID:
Mouse(76429) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Rat(361663) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Zebrafish(100073345) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
cow(534183) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
domestic cat(101100004) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
dog(486930) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
chicken(426415) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
sheep(101104360) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
domestic guinea pig(100735248) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
naked mole-rat(101723766) phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_486016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_486016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_486016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_029609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003831 MISSION® esiRNA esiRNA targeting human LHPP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022126 Rosetta Predictions human pricing
NM_001009706 Rosetta Predictions rat pricing
NM_029609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107340 predicted 542
2 SASI_Hs01_00107341 predicted 304
3 SASI_Hs01_00107343 predicted 358
4 SASI_Hs01_00107344 predicted 364
5 SASI_Hs01_00107345 predicted 457
6 SASI_Hs02_00355523 predicted 547
7 SASI_Hs01_00107346 predicted 1182
8 SASI_Hs01_00107348 predicted 303
9 SASI_Hs01_00107349 predicted 526
10 SASI_Hs02_00355524 predicted 1254
11 SASI_Hs01_00107342 predicted 588
12 SASI_Hs01_00107347 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079524 predicted 1241
2 SASI_Rn01_00079525 predicted 1254
3 SASI_Rn01_00079526 predicted 626
4 SASI_Rn01_00079527 predicted 1272
5 SASI_Rn01_00079528 predicted 509
6 SASI_Rn01_00079529 predicted 1212
7 SASI_Rn01_00079530 predicted 1269
8 SASI_Rn01_00079531 predicted 710
9 SASI_Rn01_00079533 predicted 1289
10 SASI_Rn02_00199768 predicted 1286
11 SASI_Rn01_00079532 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055563 predicted 349
2 SASI_Mm01_00055564 predicted 583
3 SASI_Mm01_00055566 predicted 688
4 SASI_Mm01_00055567 predicted 764
5 SASI_Mm01_00055568 predicted 532
6 SASI_Mm01_00055569 predicted 381
7 SASI_Mm01_00055570 predicted 385
8 SASI_Mm01_00055571 predicted 566
9 SASI_Mm01_00055572 predicted 359
10 SASI_Mm02_00335591 predicted 1219
11 SASI_Mm01_00055565 predicted 1209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022126
VALIDATED
LHPP MISSION shRNA Bacterial Glycerol Stock
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-368s1c1
Sequence:CCGGCAACCCAAACTGTGTGGTAATCTCGAGATTACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022126.2-533s1c1
Sequence:CCGGCTACATGAAGGCGCTTGAGTACTCGAGTACTCAAGCGCCTTCATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022126.2-463s1c1
Sequence:CCGGCTGTGCTCATATCACTGGGAACTCGAGTTCCCAGTGATATGAGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-338s1c1
Sequence:CCGGCCGCTCAGAATTTGATCAGATCTCGAGATCTGATCAAATTCTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-356s1c1
Sequence:CCGGGATCGACACATCCAACCCAAACTCGAGTTTGGGTTGGATGTGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-550s21c1
Sequence:GTACCGGAGTATGCCTGTGGCATCAAAGCTCGAGCTTTGATGCCACAGGCATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-521s21c1
Sequence:GTACCGGGGACGTTGGTCCCTACATGAACTCGAGTTCATGTAGGGACCAACGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022126.2-1173s21c1
Sequence:CCGGACCACTCACCATGGGCCTTTACTCGAGTAAAGGCCCATGGTGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_022126.2-368s21c1
Sequence:CCGGCAACCCAAACTGTGTGGTAATCTCGAGATTACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-356s21c1
Sequence:CCGGGATCGACACATCCAACCCAAACTCGAGTTTGGGTTGGATGTGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022126.2-338s21c1
Sequence:CCGGCCGCTCAGAATTTGATCAGATCTCGAGATCTGATCAAATTCTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022126
VALIDATED
LHPP MISSION shRNA shRNA Plasmid DNA
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-368s1c1
Sequence:CCGGCAACCCAAACTGTGTGGTAATCTCGAGATTACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022126.2-533s1c1
Sequence:CCGGCTACATGAAGGCGCTTGAGTACTCGAGTACTCAAGCGCCTTCATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022126.2-463s1c1
Sequence:CCGGCTGTGCTCATATCACTGGGAACTCGAGTTCCCAGTGATATGAGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-338s1c1
Sequence:CCGGCCGCTCAGAATTTGATCAGATCTCGAGATCTGATCAAATTCTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-356s1c1
Sequence:CCGGGATCGACACATCCAACCCAAACTCGAGTTTGGGTTGGATGTGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-550s21c1
Sequence:GTACCGGAGTATGCCTGTGGCATCAAAGCTCGAGCTTTGATGCCACAGGCATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-521s21c1
Sequence:GTACCGGGGACGTTGGTCCCTACATGAACTCGAGTTCATGTAGGGACCAACGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022126.2-1173s21c1
Sequence:CCGGACCACTCACCATGGGCCTTTACTCGAGTAAAGGCCCATGGTGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_022126.2-368s21c1
Sequence:CCGGCAACCCAAACTGTGTGGTAATCTCGAGATTACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-356s21c1
Sequence:CCGGGATCGACACATCCAACCCAAACTCGAGTTTGGGTTGGATGTGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022126.2-338s21c1
Sequence:CCGGCCGCTCAGAATTTGATCAGATCTCGAGATCTGATCAAATTCTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022126
VALIDATED
LHPP MISSION shRNA Lentiviral Transduction Particles
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-368s1c1
Sequence:CCGGCAACCCAAACTGTGTGGTAATCTCGAGATTACCACACAGTTTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022126.2-533s1c1
Sequence:CCGGCTACATGAAGGCGCTTGAGTACTCGAGTACTCAAGCGCCTTCATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022126.2-463s1c1
Sequence:CCGGCTGTGCTCATATCACTGGGAACTCGAGTTCCCAGTGATATGAGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-338s1c1
Sequence:CCGGCCGCTCAGAATTTGATCAGATCTCGAGATCTGATCAAATTCTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022126.2-356s1c1
Sequence:CCGGGATCGACACATCCAACCCAAACTCGAGTTTGGGTTGGATGTGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-550s21c1
Sequence:GTACCGGAGTATGCCTGTGGCATCAAAGCTCGAGCTTTGATGCCACAGGCATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-521s21c1
Sequence:GTACCGGGGACGTTGGTCCCTACATGAACTCGAGTTCATGTAGGGACCAACGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022126.2-1173s21c1
Sequence:CCGGACCACTCACCATGGGCCTTTACTCGAGTAAAGGCCCATGGTGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_022126.2-368s21c1
Sequence:CCGGCAACCCAAACTGTGTGGTAATCTCGAGATTACCACACAGTTTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022126.2-356s21c1
Sequence:CCGGGATCGACACATCCAACCCAAACTCGAGTTTGGGTTGGATGTGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_022126.2-338s21c1
Sequence:CCGGCCGCTCAGAATTTGATCAGATCTCGAGATCTGATCAAATTCTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_486016
VALIDATED
LHPP MISSION shRNA Bacterial Glycerol Stock
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-1251s1c1
Sequence:CCGGCCTTTAATTGACCATCCAATTCTCGAGAATTGGATGGTCAATTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-201s1c1
Sequence:CCGGCGCTGAAAGTGAGGTTCTGTACTCGAGTACAGAACCTCACTTTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486016.1-850s1c1
Sequence:CCGGGCTGCTGAAGTACACGGACAACTCGAGTTGTCCGTGTACTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-353s1c1
Sequence:CCGGCCACACTTGCTTATCCATGAACTCGAGTTCATGGATAAGCAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-409s1c1
Sequence:CCGGCAACCCAAACTGTGTGGTGATCTCGAGATCACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_486016
VALIDATED
LHPP MISSION shRNA shRNA Plasmid DNA
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-1251s1c1
Sequence:CCGGCCTTTAATTGACCATCCAATTCTCGAGAATTGGATGGTCAATTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-201s1c1
Sequence:CCGGCGCTGAAAGTGAGGTTCTGTACTCGAGTACAGAACCTCACTTTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486016.1-850s1c1
Sequence:CCGGGCTGCTGAAGTACACGGACAACTCGAGTTGTCCGTGTACTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-353s1c1
Sequence:CCGGCCACACTTGCTTATCCATGAACTCGAGTTCATGGATAAGCAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-409s1c1
Sequence:CCGGCAACCCAAACTGTGTGGTGATCTCGAGATCACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_486016
VALIDATED
LHPP MISSION shRNA Lentiviral Transduction Particles
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-1251s1c1
Sequence:CCGGCCTTTAATTGACCATCCAATTCTCGAGAATTGGATGGTCAATTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-201s1c1
Sequence:CCGGCGCTGAAAGTGAGGTTCTGTACTCGAGTACAGAACCTCACTTTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_486016.1-850s1c1
Sequence:CCGGGCTGCTGAAGTACACGGACAACTCGAGTTGTCCGTGTACTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-353s1c1
Sequence:CCGGCCACACTTGCTTATCCATGAACTCGAGTTCATGGATAAGCAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_486016.1-409s1c1
Sequence:CCGGCAACCCAAACTGTGTGGTGATCTCGAGATCACCACACAGTTTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029609
LHPP MISSION shRNA Bacterial Glycerol Stock
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000363623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029609.1-411s21c1
Sequence:CCGGCAACCCAAACTGTGTGGTGATCTCGAGATCACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029609.1-203s21c1
Sequence:CCGGCGCTGAAAGTGAGGTTCTGTACTCGAGTACAGAACCTCACTTTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029609.1-1253s21c1
Sequence:CCGGCCTTTAATTGACCATCCAATTCTCGAGAATTGGATGGTCAATTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029609
LHPP MISSION shRNA shRNA Plasmid DNA
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000363623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029609.1-411s21c1
Sequence:CCGGCAACCCAAACTGTGTGGTGATCTCGAGATCACCACACAGTTTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029609.1-203s21c1
Sequence:CCGGCGCTGAAAGTGAGGTTCTGTACTCGAGTACAGAACCTCACTTTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029609.1-1253s21c1
Sequence:CCGGCCTTTAATTGACCATCCAATTCTCGAGAATTGGATGGTCAATTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029609
LHPP MISSION shRNA Lentiviral Transduction Particles
phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000363623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029609.1-411s21c1
Sequence:CCGGCAACCCAAACTGTGTGGTGATCTCGAGATCACCACACAGTTTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029609.1-203s21c1
Sequence:CCGGCGCTGAAAGTGAGGTTCTGTACTCGAGTACAGAACCTCACTTTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029609.1-1253s21c1
Sequence:CCGGCCTTTAATTGACCATCCAATTCTCGAGAATTGGATGGTCAATTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)