EMAIL THIS PAGE TO A FRIEND

LHX1

LIM homeobox 1

56 Gene Product Result for
Synonyms: LIM-1 LIM1
UniProtKB ID: P48742, Q3MIW0
Gene ID:
Human(3975) Summary: This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
Mouse(16869) LIM homeobox protein 1
Rat(257634) LIM homeobox 1
chicken(396381) LIM homeobox 1
cow(616699) LIM homeobox 1
cow(786041) LIM homeobox 1
domestic cat(101083467) LIM homeobox 1
dog(610326) LIM homeobox 1
sheep(101109722) LIM homeobox 1
naked mole-rat(101704561) LIM homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100199 Anti-LHX1 (166-180) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100200 Anti-LHX1 (331-345) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV32374 Anti-LHX1 (AB1) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, rat, bovine, canine, mouse, rabbit, horse
western blot pricing
AV100851 Anti-LHX1 (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, zebrafish, human, rat, bovine
immunohistochemistry, western blot pricing
SAB1412493 ANTI-LHX1 antibody produced in mouse clone 1C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412506 ANTI-LHX1 antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412507 ANTI-LHX1 antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412508 ANTI-LHX1 antibody produced in mouse clone 1F1, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412509 ANTI-LHX1 antibody produced in mouse clone 4A5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412510 ANTI-LHX1 antibody produced in mouse clone 2G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1412511 ANTI-LHX1 antibody produced in mouse clone 4G5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1412537 ANTI-LHX1 antibody produced in mouse clone 2A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412538 ANTI-LHX1 antibody produced in mouse clone 2A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412565 ANTI-LHX1 antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
WH0003975M1 Monoclonal Anti-LHX1 antibody produced in mouse clone 4D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1404023 Monoclonal Anti-LHX1, (N-terminal) antibody produced in mouse clone 2H1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005568 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085721 MISSION® esiRNA esiRNA targeting mouse Lhx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005568 Rosetta Predictions human pricing
NM_145880 Rosetta Predictions rat pricing
NM_008498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184682 predicted 1659
2 SASI_Hs01_00184683 predicted 1130
3 SASI_Hs01_00184684 predicted 1156
4 SASI_Hs01_00184685 predicted 1471
5 SASI_Hs01_00184686 predicted 1086
6 SASI_Hs01_00184687 predicted 1347
7 SASI_Hs01_00184688 predicted 1066
8 SASI_Hs01_00184689 predicted 1690
9 SASI_Hs01_00184690 predicted 1408
10 SASI_Hs01_00184691 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065230 predicted 1213
2 SASI_Rn01_00065231 predicted 1001
3 SASI_Rn01_00065232 predicted 761
4 SASI_Rn02_00268809 predicted 1097
5 SASI_Rn01_00065233 predicted 1106
6 SASI_Rn01_00065234 predicted 1014
7 SASI_Rn01_00065235 predicted 1174
8 SASI_Rn01_00065236 predicted 1251
9 SASI_Rn01_00065237 predicted 1205
10 SASI_Rn01_00065238 predicted 839
11 SASI_Rn01_00065239 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185056 predicted 1761
2 SASI_Mm01_00185058 predicted 1770
3 SASI_Mm01_00185059 predicted 2007
4 SASI_Mm01_00185060 predicted 1599
5 SASI_Mm01_00185061 predicted 1859
6 SASI_Mm01_00185062 predicted 1831
7 SASI_Mm01_00185063 predicted 1666
8 SASI_Mm01_00185064 predicted 1932
9 SASI_Mm01_00185065 predicted 2362
10 SASI_Mm02_00314048 predicted 1910
11 SASI_Mm01_00185057 predicted 1522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008498
LHX1 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008498.2-1592s21c1
Sequence:CCGGGAGCGCGAAGCAAAGTGTTTCCTCGAGGAAACACTTTGCTTCGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1683s1c1
Sequence:CCGGCGAGAACAAGTTCGTTTGTAACTCGAGTTACAAACGAACTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1443s1c1
Sequence:CCGGCGTCCAGTGCTGTGAATGTAACTCGAGTTACATTCACAGCACTGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1668s1c1
Sequence:CCGGGCTCTACATCATAGACGAGAACTCGAGTTCTCGTCTATGATGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-2379s1c1
Sequence:CCGGGCAGCGATTTACTGACATCCTCTCGAGAGGATGTCAGTAAATCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1398s1c1
Sequence:CCGGCCGTTTCCTCTTGAACGTGTTCTCGAGAACACGTTCAAGAGGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008498
LHX1 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008498.2-1592s21c1
Sequence:CCGGGAGCGCGAAGCAAAGTGTTTCCTCGAGGAAACACTTTGCTTCGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1683s1c1
Sequence:CCGGCGAGAACAAGTTCGTTTGTAACTCGAGTTACAAACGAACTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1443s1c1
Sequence:CCGGCGTCCAGTGCTGTGAATGTAACTCGAGTTACATTCACAGCACTGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1668s1c1
Sequence:CCGGGCTCTACATCATAGACGAGAACTCGAGTTCTCGTCTATGATGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-2379s1c1
Sequence:CCGGGCAGCGATTTACTGACATCCTCTCGAGAGGATGTCAGTAAATCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1398s1c1
Sequence:CCGGCCGTTTCCTCTTGAACGTGTTCTCGAGAACACGTTCAAGAGGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008498
LHX1 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008498.2-1592s21c1
Sequence:CCGGGAGCGCGAAGCAAAGTGTTTCCTCGAGGAAACACTTTGCTTCGCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1683s1c1
Sequence:CCGGCGAGAACAAGTTCGTTTGTAACTCGAGTTACAAACGAACTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1443s1c1
Sequence:CCGGCGTCCAGTGCTGTGAATGTAACTCGAGTTACATTCACAGCACTGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1668s1c1
Sequence:CCGGGCTCTACATCATAGACGAGAACTCGAGTTCTCGTCTATGATGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-2379s1c1
Sequence:CCGGGCAGCGATTTACTGACATCCTCTCGAGAGGATGTCAGTAAATCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008498.1-1398s1c1
Sequence:CCGGCCGTTTCCTCTTGAACGTGTTCTCGAGAACACGTTCAAGAGGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005568
LHX1 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1152s1c1
Sequence:CCGGGAACGACTTCTTCCGGTGTTTCTCGAGAAACACCGGAAGAAGTCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1086s1c1
Sequence:CCGGGTGCTGTGAATGTAAATGCAACTCGAGTTGCATTTACATTCACAGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1366s1c1
Sequence:CCGGGTTGCCAAAGAGAACAGCCTTCTCGAGAAGGCTGTTCTCTTTGGCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1819s1c1
Sequence:CCGGCCCTTCTCCTTCTACGGAGATCTCGAGATCTCCGTAGAAGGAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1333s1c1
Sequence:CCGGGTCTGCAAAGAGGATTACCTACTCGAGTAGGTAATCCTCTTTGCAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005568
LHX1 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1152s1c1
Sequence:CCGGGAACGACTTCTTCCGGTGTTTCTCGAGAAACACCGGAAGAAGTCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1086s1c1
Sequence:CCGGGTGCTGTGAATGTAAATGCAACTCGAGTTGCATTTACATTCACAGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1366s1c1
Sequence:CCGGGTTGCCAAAGAGAACAGCCTTCTCGAGAAGGCTGTTCTCTTTGGCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1819s1c1
Sequence:CCGGCCCTTCTCCTTCTACGGAGATCTCGAGATCTCCGTAGAAGGAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1333s1c1
Sequence:CCGGGTCTGCAAAGAGGATTACCTACTCGAGTAGGTAATCCTCTTTGCAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005568
LHX1 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1152s1c1
Sequence:CCGGGAACGACTTCTTCCGGTGTTTCTCGAGAAACACCGGAAGAAGTCGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1086s1c1
Sequence:CCGGGTGCTGTGAATGTAAATGCAACTCGAGTTGCATTTACATTCACAGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1366s1c1
Sequence:CCGGGTTGCCAAAGAGAACAGCCTTCTCGAGAAGGCTGTTCTCTTTGGCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1819s1c1
Sequence:CCGGCCCTTCTCCTTCTACGGAGATCTCGAGATCTCCGTAGAAGGAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005568.2-1333s1c1
Sequence:CCGGGTCTGCAAAGAGGATTACCTACTCGAGTAGGTAATCCTCTTTGCAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)