EMAIL THIS PAGE TO A FRIEND

LHX2

LIM homeobox 2

78 Gene Product Result for
Synonyms: LH2 hLhx2
UniProtKB ID: P50458, O95860, Q52M57, Q8N1Z3
Gene ID:
Human(9355) Summary: This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator. The protein can recapitulate or rescue phenotypes in Drosophila caused by a related protein, suggesting conservation of function during evolution. [provided by RefSeq, Jul 2008]
Mouse(16870) LIM homeobox protein 2
Rat(296706) LIM homeobox 2
chicken(395705) LIM homeobox 2
dog(491340) LIM homeobox 2
cow(783763) LIM homeobox 2
domestic cat(101088628) LIM homeobox 2
naked mole-rat(101720657) LIM homeobox 2
sheep(101108898) LIM homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004789 Rosetta Predictions human pricing
NM_001106571 Rosetta Predictions rat pricing
NM_010710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338309 predicted 1690
2 SASI_Hs01_00023021 predicted 1488
3 SASI_Hs01_00023022 predicted 1574
4 SASI_Hs01_00023023 predicted 1858
5 SASI_Hs01_00023024 predicted 1452
6 SASI_Hs01_00023025 predicted 1126
7 SASI_Hs01_00023026 predicted 1053
8 SASI_Hs01_00023027 predicted 1567
9 SASI_Hs01_00023028 predicted 962
10 SASI_Hs01_00023029 predicted 1867
11 SASI_Hs01_00023030 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220268 predicted 897
2 SASI_Rn02_00220269 predicted 1370
3 SASI_Rn02_00220270 predicted 578
4 SASI_Rn02_00220271 predicted 259
5 SASI_Rn02_00220272 predicted 582
6 SASI_Rn02_00220273 predicted 290
7 SASI_Rn02_00220274 predicted 368
8 SASI_Rn02_00220275 predicted 317
9 SASI_Rn02_00220276 predicted 1322
10 SASI_Rn02_00220277 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073386 predicted 988
2 SASI_Mm01_00073387 predicted 1309
3 SASI_Mm01_00073388 predicted 1780
4 SASI_Mm01_00073389 predicted 984
5 SASI_Mm01_00073390 predicted 777
6 SASI_Mm01_00073391 predicted 1550
7 SASI_Mm01_00073392 predicted 1547
8 SASI_Mm01_00073393 predicted 1727
9 SASI_Mm01_00073394 predicted 1341
10 SASI_Mm01_00073395 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010710
LHX2 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1654s1c1
Sequence:CCGGGCCCTTCACAAACGACTCTTACTCGAGTAAGAGTCGTTTGTGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1323s1c1
Sequence:CCGGGCCATTAACCACAATCCCGATCTCGAGATCGGGATTGTGGTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-887s1c1
Sequence:CCGGCTTCACATGCACAACGTGTAACTCGAGTTACACGTTGTGCATGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010710.2-2000s1c1
Sequence:CCGGCGTGCCTTAGGAATACTGTTTCTCGAGAAACAGTATTCCTAAGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1197s1c1
Sequence:CCGGCTTAGCTGTAACGAGAACGATCTCGAGATCGTTCTCGTTACAGCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-1302s21c1
Sequence:CCGGGGACAATGAAGTCTTACTTTGCTCGAGCAAAGTAAGACTTCATTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-767s21c1
Sequence:GTACCGGTACTGCAAAGAAGACTACTACCTCGAGGTAGTAGTCTTCTTTGCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010710.3-1874s21c1
Sequence:CCGGGGAATTACTTGGGAGATATATCTCGAGATATATCTCCCAAGTAATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-991s21c1
Sequence:CCGGCGAATACCCAGCACACTTTAACTCGAGTTAAAGTGTGCTGGGTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-887s21c1
Sequence:CCGGTTCACATGCACAACGTGTAACCTCGAGGTTACACGTTGTGCATGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010710
LHX2 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1654s1c1
Sequence:CCGGGCCCTTCACAAACGACTCTTACTCGAGTAAGAGTCGTTTGTGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1323s1c1
Sequence:CCGGGCCATTAACCACAATCCCGATCTCGAGATCGGGATTGTGGTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-887s1c1
Sequence:CCGGCTTCACATGCACAACGTGTAACTCGAGTTACACGTTGTGCATGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010710.2-2000s1c1
Sequence:CCGGCGTGCCTTAGGAATACTGTTTCTCGAGAAACAGTATTCCTAAGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1197s1c1
Sequence:CCGGCTTAGCTGTAACGAGAACGATCTCGAGATCGTTCTCGTTACAGCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-1302s21c1
Sequence:CCGGGGACAATGAAGTCTTACTTTGCTCGAGCAAAGTAAGACTTCATTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-767s21c1
Sequence:GTACCGGTACTGCAAAGAAGACTACTACCTCGAGGTAGTAGTCTTCTTTGCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010710.3-1874s21c1
Sequence:CCGGGGAATTACTTGGGAGATATATCTCGAGATATATCTCCCAAGTAATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-991s21c1
Sequence:CCGGCGAATACCCAGCACACTTTAACTCGAGTTAAAGTGTGCTGGGTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-887s21c1
Sequence:CCGGTTCACATGCACAACGTGTAACCTCGAGGTTACACGTTGTGCATGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010710
LHX2 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1654s1c1
Sequence:CCGGGCCCTTCACAAACGACTCTTACTCGAGTAAGAGTCGTTTGTGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1323s1c1
Sequence:CCGGGCCATTAACCACAATCCCGATCTCGAGATCGGGATTGTGGTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-887s1c1
Sequence:CCGGCTTCACATGCACAACGTGTAACTCGAGTTACACGTTGTGCATGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010710.2-2000s1c1
Sequence:CCGGCGTGCCTTAGGAATACTGTTTCTCGAGAAACAGTATTCCTAAGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010710.2-1197s1c1
Sequence:CCGGCTTAGCTGTAACGAGAACGATCTCGAGATCGTTCTCGTTACAGCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-1302s21c1
Sequence:CCGGGGACAATGAAGTCTTACTTTGCTCGAGCAAAGTAAGACTTCATTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-767s21c1
Sequence:GTACCGGTACTGCAAAGAAGACTACTACCTCGAGGTAGTAGTCTTCTTTGCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010710.3-1874s21c1
Sequence:CCGGGGAATTACTTGGGAGATATATCTCGAGATATATCTCCCAAGTAATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-991s21c1
Sequence:CCGGCGAATACCCAGCACACTTTAACTCGAGTTAAAGTGTGCTGGGTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010710.3-887s21c1
Sequence:CCGGTTCACATGCACAACGTGTAACCTCGAGGTTACACGTTGTGCATGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004789
LHX2 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004789.3-2135s1c1
Sequence:CCGGCCGAGGAACAACTTGGAAGATCTCGAGATCTTCCAAGTTGTTCCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1707s1c1
Sequence:CCGGGCAACCTCTTACGGCAGGAAACTCGAGTTTCCTGCCGTAAGAGGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1165s1c1
Sequence:CCGGGTGCACCACGTGTAACAAGATCTCGAGATCTTGTTACACGTGGTGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1570s1c1
Sequence:CCGGGCTTCGGACCATGAAGTCTTACTCGAGTAAGACTTCATGGTCCGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1866s21c1
Sequence:CCGGCAACTGTGACGTCCGTCTTAACTCGAGTTAAGACGGACGTCACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1623s21c1
Sequence:CCGGACTTGAAGCAGCTCGCGCAAACTCGAGTTTGCGCGAGCTGCTTCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-913s21c1
Sequence:CCGGCAAGATCTCGGACCGCTACTACTCGAGTAGTAGCGGTCCGAGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1051s21c1
Sequence:CCGGAGACTACTACAGGCGCTTCTCCTCGAGGAGAAGCGCCTGTAGTAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004789
LHX2 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004789.3-2135s1c1
Sequence:CCGGCCGAGGAACAACTTGGAAGATCTCGAGATCTTCCAAGTTGTTCCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1707s1c1
Sequence:CCGGGCAACCTCTTACGGCAGGAAACTCGAGTTTCCTGCCGTAAGAGGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1165s1c1
Sequence:CCGGGTGCACCACGTGTAACAAGATCTCGAGATCTTGTTACACGTGGTGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1570s1c1
Sequence:CCGGGCTTCGGACCATGAAGTCTTACTCGAGTAAGACTTCATGGTCCGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1866s21c1
Sequence:CCGGCAACTGTGACGTCCGTCTTAACTCGAGTTAAGACGGACGTCACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1623s21c1
Sequence:CCGGACTTGAAGCAGCTCGCGCAAACTCGAGTTTGCGCGAGCTGCTTCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-913s21c1
Sequence:CCGGCAAGATCTCGGACCGCTACTACTCGAGTAGTAGCGGTCCGAGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1051s21c1
Sequence:CCGGAGACTACTACAGGCGCTTCTCCTCGAGGAGAAGCGCCTGTAGTAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004789
LHX2 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004789.3-2135s1c1
Sequence:CCGGCCGAGGAACAACTTGGAAGATCTCGAGATCTTCCAAGTTGTTCCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1707s1c1
Sequence:CCGGGCAACCTCTTACGGCAGGAAACTCGAGTTTCCTGCCGTAAGAGGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1165s1c1
Sequence:CCGGGTGCACCACGTGTAACAAGATCTCGAGATCTTGTTACACGTGGTGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004789.3-1570s1c1
Sequence:CCGGGCTTCGGACCATGAAGTCTTACTCGAGTAAGACTTCATGGTCCGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1866s21c1
Sequence:CCGGCAACTGTGACGTCCGTCTTAACTCGAGTTAAGACGGACGTCACAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1623s21c1
Sequence:CCGGACTTGAAGCAGCTCGCGCAAACTCGAGTTTGCGCGAGCTGCTTCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-913s21c1
Sequence:CCGGCAAGATCTCGGACCGCTACTACTCGAGTAGTAGCGGTCCGAGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004789.3-1051s21c1
Sequence:CCGGAGACTACTACAGGCGCTTCTCCTCGAGGAGAAGCGCCTGTAGTAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)