EMAIL THIS PAGE TO A FRIEND

LHX5

LIM homeobox 5

50 Gene Product Result for
UniProtKB ID: Q9H2C1, Q32MA4
Gene ID:
Human(64211) Summary: This gene encodes a protein belonging to a large protein family, members of which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator and be involved in the control of differentiation and development of the forebrain. In mice, this protein is essential for the regulation of precursor cell proliferation and the control of neuronal differentiation and migration during hippocampal development. This protein is involved in learning and motor functions in adult mice. [provided by RefSeq, Jul 2008]
Mouse(16873) LIM homeobox protein 5
Rat(124451) LIM homeobox 5
Zebrafish(30465) LIM homeobox 5
cow(520759) LIM homeobox 5
chicken(771259) LIM homeobox 5
domestic cat(101090143) LIM homeobox 5
dog(486283) LIM homeobox 5
sheep(101111831) LIM homeobox 5
naked mole-rat(101721214) LIM homeobox 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022363 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022363 Rosetta Predictions human pricing
NM_139036 Rosetta Predictions rat pricing
NM_008499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017854 predicted 820
2 SASI_Hs01_00017855 predicted 900
3 SASI_Hs01_00017856 predicted 974
4 SASI_Hs01_00017857 predicted 1408
5 SASI_Hs01_00017858 predicted 1395
6 SASI_Hs01_00017859 predicted 1088
7 SASI_Hs01_00017860 predicted 942
8 SASI_Hs01_00017861 predicted 652
9 SASI_Hs01_00017862 predicted 640
10 SASI_Hs02_00355661 predicted 923
11 SASI_Hs01_00017863 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080731 predicted 1620
2 SASI_Rn01_00080732 predicted 1266
3 SASI_Rn01_00080733 predicted 706
4 SASI_Rn01_00080734 predicted 876
5 SASI_Rn01_00080735 predicted 600
6 SASI_Rn02_00268414 predicted 465
7 SASI_Rn01_00080736 predicted 1374
8 SASI_Rn01_00080737 predicted 441
9 SASI_Rn01_00080738 predicted 754
10 SASI_Rn01_00080739 predicted 980
11 SASI_Rn01_00080740 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034159 predicted 438
2 SASI_Mm01_00034160 predicted 1040
3 SASI_Mm01_00034161 predicted 699
4 SASI_Mm01_00034162 predicted 1233
5 SASI_Mm01_00034163 predicted 906
6 SASI_Mm01_00034164 predicted 876
7 SASI_Mm01_00034165 predicted 635
8 SASI_Mm01_00034166 predicted 479
9 SASI_Mm01_00034167 predicted 1212
10 SASI_Mm01_00034168 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022363
LHX5 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-1367s21c1
Sequence:CCGGTTGGACGAGTCTGAGATGTTGCTCGAGCAACATCTCAGACTCGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-744s21c1
Sequence:CCGGTCAGGCGCTTTGGCACGAAATCTCGAGATTTCGTGCCAAAGCGCCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-976s21c1
Sequence:CCGGATCCTGTACGGACCGCAGTTTCTCGAGAAACTGCGGTCCGTACAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022363.2-1908s1c1
Sequence:CCGGGTCCGCACTCAACTGGCAGCTCTCGAGAGCTGCCAGTTGAGTGCGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-644s1c1
Sequence:CCGGGCGTGGCACATCAAATGTGTTCTCGAGAACACATTTGATGTGCCACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-1399s1c1
Sequence:CCGGGTACACCTACTACGGAGACTACTCGAGTAGTCTCCGTAGTAGGTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-910s1c1
Sequence:CCGGGTTCGTGTGCAAAGACGACTACTCGAGTAGTCGTCTTTGCACACGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-832s1c1
Sequence:CCGGCCTCAACTGTTTCACCTGCATCTCGAGATGCAGGTGAAACAGTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022363
LHX5 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-1367s21c1
Sequence:CCGGTTGGACGAGTCTGAGATGTTGCTCGAGCAACATCTCAGACTCGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-744s21c1
Sequence:CCGGTCAGGCGCTTTGGCACGAAATCTCGAGATTTCGTGCCAAAGCGCCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-976s21c1
Sequence:CCGGATCCTGTACGGACCGCAGTTTCTCGAGAAACTGCGGTCCGTACAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022363.2-1908s1c1
Sequence:CCGGGTCCGCACTCAACTGGCAGCTCTCGAGAGCTGCCAGTTGAGTGCGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-644s1c1
Sequence:CCGGGCGTGGCACATCAAATGTGTTCTCGAGAACACATTTGATGTGCCACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-1399s1c1
Sequence:CCGGGTACACCTACTACGGAGACTACTCGAGTAGTCTCCGTAGTAGGTGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-910s1c1
Sequence:CCGGGTTCGTGTGCAAAGACGACTACTCGAGTAGTCGTCTTTGCACACGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-832s1c1
Sequence:CCGGCCTCAACTGTTTCACCTGCATCTCGAGATGCAGGTGAAACAGTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022363
LHX5 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-1367s21c1
Sequence:CCGGTTGGACGAGTCTGAGATGTTGCTCGAGCAACATCTCAGACTCGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-744s21c1
Sequence:CCGGTCAGGCGCTTTGGCACGAAATCTCGAGATTTCGTGCCAAAGCGCCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022363.2-976s21c1
Sequence:CCGGATCCTGTACGGACCGCAGTTTCTCGAGAAACTGCGGTCCGTACAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022363.2-1908s1c1
Sequence:CCGGGTCCGCACTCAACTGGCAGCTCTCGAGAGCTGCCAGTTGAGTGCGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-644s1c1
Sequence:CCGGGCGTGGCACATCAAATGTGTTCTCGAGAACACATTTGATGTGCCACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-1399s1c1
Sequence:CCGGGTACACCTACTACGGAGACTACTCGAGTAGTCTCCGTAGTAGGTGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-910s1c1
Sequence:CCGGGTTCGTGTGCAAAGACGACTACTCGAGTAGTCGTCTTTGCACACGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022363.2-832s1c1
Sequence:CCGGCCTCAACTGTTTCACCTGCATCTCGAGATGCAGGTGAAACAGTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008499
LHX5 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-452s1c1
Sequence:CCGGGCGTGGCATATCAAATGTGTTCTCGAGAACACATTTGATATGCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-425s1c1
Sequence:CCGGCGCTTTCTGCTGAACGTACTACTCGAGTAGTACGTTCAGCAGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-1248s1c1
Sequence:CCGGCGGGAGGCAATTACGATTTCTCTCGAGAGAAATCGTAATTGCCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-881s1c1
Sequence:CCGGGCTAACAACGAGAATGAGGAACTCGAGTTCCTCATTCTCGTTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-709s1c1
Sequence:CCGGCGAGAACAAGTTTGTGTGCAACTCGAGTTGCACACAAACTTGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008499
LHX5 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-452s1c1
Sequence:CCGGGCGTGGCATATCAAATGTGTTCTCGAGAACACATTTGATATGCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-425s1c1
Sequence:CCGGCGCTTTCTGCTGAACGTACTACTCGAGTAGTACGTTCAGCAGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-1248s1c1
Sequence:CCGGCGGGAGGCAATTACGATTTCTCTCGAGAGAAATCGTAATTGCCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-881s1c1
Sequence:CCGGGCTAACAACGAGAATGAGGAACTCGAGTTCCTCATTCTCGTTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-709s1c1
Sequence:CCGGCGAGAACAAGTTTGTGTGCAACTCGAGTTGCACACAAACTTGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008499
LHX5 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-452s1c1
Sequence:CCGGGCGTGGCATATCAAATGTGTTCTCGAGAACACATTTGATATGCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-425s1c1
Sequence:CCGGCGCTTTCTGCTGAACGTACTACTCGAGTAGTACGTTCAGCAGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-1248s1c1
Sequence:CCGGCGGGAGGCAATTACGATTTCTCTCGAGAGAAATCGTAATTGCCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-881s1c1
Sequence:CCGGGCTAACAACGAGAATGAGGAACTCGAGTTCCTCATTCTCGTTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008499.2-709s1c1
Sequence:CCGGCGAGAACAAGTTTGTGTGCAACTCGAGTTGCACACAAACTTGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)