EMAIL THIS PAGE TO A FRIEND

LHX6

LIM homeobox 6

270 Gene Product Result for
Synonyms: LHX6.1
Gene ID:
Human(26468) Summary: This gene encodes a member of a large protein family that contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein may function as a transcriptional regulator and may be involved in the control of differentiation and development of neural and lymphoid cells. Two alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. Alternatively spliced transcript variants have been identified, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(16874) LIM homeobox protein 6
Rat(311901) LIM homeobox 6
naked mole-rat(101701964) LIM homeobox 6
sheep(101113740) LIM homeobox 6
Zebrafish(445565) LIM homeobox 6
cow(541261) LIM homeobox 6
domestic cat(101091662) LIM homeobox 6
dog(491354) LIM homeobox 6
chicken(772259) LIM homeobox 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301543 ANTI-LHX6 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
SAB1412154 ANTI-LHX6 antibody produced in mouse clone 2A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412161 ANTI-LHX6 antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2701881 Anti-lhx6 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB2107891 Anti-LHX6 antibody produced in rabbit IgG fraction of antiserum rat, human, dog
immunohistochemistry, western blot pricing
AV32553 Anti-LHX6 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder mouse, canine, bovine, rat, human
immunohistochemistry, western blot pricing
HPA047854 Anti-LHX6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0026468M1 Monoclonal Anti-LHX6 antibody produced in mouse clone 3D9, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB1405019 Monoclonal Anti-LHX6 antibody produced in mouse clone 3E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014368 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014368 Rosetta Predictions human pricing
NM_199160 Rosetta Predictions human pricing
NM_001107837 Rosetta Predictions rat pricing
NM_001083125 Rosetta Predictions mouse pricing
NM_001083126 Rosetta Predictions mouse pricing
NM_001083127 Rosetta Predictions mouse pricing
NM_008500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345518 predicted 397
2 SASI_Hs01_00012271 predicted 789
3 SASI_Hs01_00012272 predicted 637
4 SASI_Hs01_00012273 predicted 1545
5 SASI_Hs01_00012276 predicted 1510
6 SASI_Hs01_00012277 predicted 1474
7 SASI_Hs01_00012278 predicted 1468
8 SASI_Hs01_00012279 predicted 1612
9 SASI_Hs01_00012280 predicted 1456
10 SASI_Hs02_00345519 predicted 619
11 SASI_Hs01_00012274 predicted 1547
12 SASI_Hs01_00012275 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372586 predicted 400
2 SASI_Hs01_00177807 predicted 788
3 SASI_Hs01_00177808 predicted 642
4 SASI_Hs01_00177809 predicted 1446
5 SASI_Hs01_00177811 predicted 1405
6 SASI_Hs01_00177812 predicted 1370
7 SASI_Hs01_00177813 predicted 1363
8 SASI_Hs01_00177814 predicted 1510
9 SASI_Hs01_00177815 predicted 1355
10 SASI_Hs01_00177816 predicted 578
11 SASI_Hs01_00177810 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232765 predicted 626
2 SASI_Rn02_00232766 predicted 1550
3 SASI_Rn02_00232767 predicted 1510
4 SASI_Rn02_00232768 predicted 642
5 SASI_Rn02_00232769 predicted 629
6 SASI_Rn02_00232770 predicted 720
7 SASI_Rn02_00232771 predicted 1499
8 SASI_Rn02_00232772 predicted 374
9 SASI_Rn02_00232773 predicted 670
10 SASI_Rn02_00232774 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299514 predicted 986
2 SASI_Mm02_00299515 predicted 1659
3 SASI_Mm02_00299516 predicted 775
4 SASI_Mm02_00299517 predicted 649
5 SASI_Mm02_00299518 predicted 518
6 SASI_Mm02_00299519 predicted 870
7 SASI_Mm02_00299520 predicted 1632
8 SASI_Mm02_00299521 predicted 814
9 SASI_Mm02_00299522 predicted 607
10 SASI_Mm02_00299523 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299524 predicted 803
2 SASI_Mm02_00299525 predicted 1565
3 SASI_Mm02_00299526 predicted 592
4 SASI_Mm02_00299527 predicted 456
5 SASI_Mm02_00299528 predicted 333
6 SASI_Mm02_00299529 predicted 683
7 SASI_Mm02_00299530 predicted 1542
8 SASI_Mm02_00299531 predicted 628
9 SASI_Mm02_00299532 predicted 417
10 SASI_Mm02_00299533 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083127 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299534 predicted 804
2 SASI_Mm02_00299535 predicted 1466
3 SASI_Mm02_00299536 predicted 588
4 SASI_Mm02_00299537 predicted 463
5 SASI_Mm02_00299538 predicted 326
6 SASI_Mm02_00299539 predicted 679
7 SASI_Mm02_00299540 predicted 1438
8 SASI_Mm02_00299541 predicted 631
9 SASI_Mm02_00299542 predicted 414
10 SASI_Mm02_00299543 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093878 predicted 989
2 SASI_Mm02_00314049 predicted 1760
3 SASI_Mm02_00314050 predicted 782
4 SASI_Mm01_00093881 predicted 650
5 SASI_Mm01_00093883 predicted 525
6 SASI_Mm02_00314051 predicted 873
7 SASI_Mm02_00314052 predicted 1734
8 SASI_Mm02_00314053 predicted 816
9 SASI_Mm02_00314054 predicted 604
10 SASI_Mm02_00314055 predicted 1667
11 SASI_Mm01_00093879 predicted 625
12 SASI_Mm01_00093880 predicted 714
13 SASI_Mm01_00093882 predicted 1104
14 SASI_Mm01_00093884 predicted 1445
15 SASI_Mm01_00093885 predicted 638
16 SASI_Mm01_00093886 predicted 1445
17 SASI_Mm01_00093887 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008500
LHX6 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008500.2-528s21c1
Sequence:CCGGGTATCTGCTCAAGGTCAACAACTCGAGTTGTTGACCTTGAGCAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008500.2-1642s21c1
Sequence:CCGGAGCCTGTCTTTCCTCATTAACCTCGAGGTTAATGAGGAAAGACAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008500.2-823s21c1
Sequence:CCGGGTGCTTTGCCGCATCCATTACCTCGAGGTAATGGATGCGGCAAAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-327s1c1
Sequence:CCGGGCAAGAATATCTGCTCCAGTTCTCGAGAACTGGAGCAGATATTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-1024s1c1
Sequence:CCGGCGACATCCACTACTCTCCGTTCTCGAGAACGGAGAGTAGTGGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-811s1c1
Sequence:CCGGCGCAGAGCAATTGCAGGTTATCTCGAGATAACCTGCAATTGCTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-481s1c1
Sequence:CCGGCTACTGCAAGATGGACTACTTCTCGAGAAGTAGTCCATCTTGCAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-589s1c1
Sequence:CCGGCCTGGCATGTTTCGCCTGCTTCTCGAGAAGCAGGCGAAACATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008500
LHX6 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008500.2-528s21c1
Sequence:CCGGGTATCTGCTCAAGGTCAACAACTCGAGTTGTTGACCTTGAGCAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008500.2-1642s21c1
Sequence:CCGGAGCCTGTCTTTCCTCATTAACCTCGAGGTTAATGAGGAAAGACAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008500.2-823s21c1
Sequence:CCGGGTGCTTTGCCGCATCCATTACCTCGAGGTAATGGATGCGGCAAAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-327s1c1
Sequence:CCGGGCAAGAATATCTGCTCCAGTTCTCGAGAACTGGAGCAGATATTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-1024s1c1
Sequence:CCGGCGACATCCACTACTCTCCGTTCTCGAGAACGGAGAGTAGTGGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-811s1c1
Sequence:CCGGCGCAGAGCAATTGCAGGTTATCTCGAGATAACCTGCAATTGCTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-481s1c1
Sequence:CCGGCTACTGCAAGATGGACTACTTCTCGAGAAGTAGTCCATCTTGCAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-589s1c1
Sequence:CCGGCCTGGCATGTTTCGCCTGCTTCTCGAGAAGCAGGCGAAACATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008500
LHX6 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008500.2-528s21c1
Sequence:CCGGGTATCTGCTCAAGGTCAACAACTCGAGTTGTTGACCTTGAGCAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008500.2-1642s21c1
Sequence:CCGGAGCCTGTCTTTCCTCATTAACCTCGAGGTTAATGAGGAAAGACAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008500.2-823s21c1
Sequence:CCGGGTGCTTTGCCGCATCCATTACCTCGAGGTAATGGATGCGGCAAAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-327s1c1
Sequence:CCGGGCAAGAATATCTGCTCCAGTTCTCGAGAACTGGAGCAGATATTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-1024s1c1
Sequence:CCGGCGACATCCACTACTCTCCGTTCTCGAGAACGGAGAGTAGTGGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-811s1c1
Sequence:CCGGCGCAGAGCAATTGCAGGTTATCTCGAGATAACCTGCAATTGCTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-481s1c1
Sequence:CCGGCTACTGCAAGATGGACTACTTCTCGAGAAGTAGTCCATCTTGCAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008500.1-589s1c1
Sequence:CCGGCCTGGCATGTTTCGCCTGCTTCTCGAGAAGCAGGCGAAACATGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014368
LHX6 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014368.3-1045s21c1
Sequence:CCGGTACATTGAGAGTCAGGTACAGCTCGAGCTGTACCTGACTCTCAATGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014368.3-1517s21c1
Sequence:CCGGGCCAACGGCCTTCTCATTTACCTCGAGGTAAATGAGAAGGCCGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-412s1c1
Sequence:CCGGGATGGACTACTTCAGCCGATTCTCGAGAATCGGCTGAAGTAGTCCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-604s1c1
Sequence:CCGGCTACGACACCATGATTGAGAACTCGAGTTCTCAATCATGGTGTCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-1072s1c1
Sequence:CCGGCGTCCACCTCAAAGCCGATATCTCGAGATATCGGCTTTGAGGTGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-547s1c1
Sequence:CCGGGCTGTCCACTGGTGAGGAGTTCTCGAGAACTCCTCACCAGTGGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-745s1c1
Sequence:CCGGGCAGGTTATGCAGGCGCAGTTCTCGAGAACTGCGCCTGCATAACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014368.3-1469s21c1
Sequence:CCGGCAACTTCAGCTGATTACAATACTCGAGTATTGTAATCAGCTGAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014368.3-312s21c1
Sequence:CCGGCGAGATCCTGGACCGATATCTCTCGAGAGATATCGGTCCAGGATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014368
LHX6 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014368.3-1045s21c1
Sequence:CCGGTACATTGAGAGTCAGGTACAGCTCGAGCTGTACCTGACTCTCAATGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014368.3-1517s21c1
Sequence:CCGGGCCAACGGCCTTCTCATTTACCTCGAGGTAAATGAGAAGGCCGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-412s1c1
Sequence:CCGGGATGGACTACTTCAGCCGATTCTCGAGAATCGGCTGAAGTAGTCCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-604s1c1
Sequence:CCGGCTACGACACCATGATTGAGAACTCGAGTTCTCAATCATGGTGTCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-1072s1c1
Sequence:CCGGCGTCCACCTCAAAGCCGATATCTCGAGATATCGGCTTTGAGGTGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-547s1c1
Sequence:CCGGGCTGTCCACTGGTGAGGAGTTCTCGAGAACTCCTCACCAGTGGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-745s1c1
Sequence:CCGGGCAGGTTATGCAGGCGCAGTTCTCGAGAACTGCGCCTGCATAACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014368.3-1469s21c1
Sequence:CCGGCAACTTCAGCTGATTACAATACTCGAGTATTGTAATCAGCTGAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014368.3-312s21c1
Sequence:CCGGCGAGATCCTGGACCGATATCTCTCGAGAGATATCGGTCCAGGATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014368
LHX6 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014368.3-1045s21c1
Sequence:CCGGTACATTGAGAGTCAGGTACAGCTCGAGCTGTACCTGACTCTCAATGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014368.3-1517s21c1
Sequence:CCGGGCCAACGGCCTTCTCATTTACCTCGAGGTAAATGAGAAGGCCGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-412s1c1
Sequence:CCGGGATGGACTACTTCAGCCGATTCTCGAGAATCGGCTGAAGTAGTCCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-604s1c1
Sequence:CCGGCTACGACACCATGATTGAGAACTCGAGTTCTCAATCATGGTGTCGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-1072s1c1
Sequence:CCGGCGTCCACCTCAAAGCCGATATCTCGAGATATCGGCTTTGAGGTGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-547s1c1
Sequence:CCGGGCTGTCCACTGGTGAGGAGTTCTCGAGAACTCCTCACCAGTGGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014368.2-745s1c1
Sequence:CCGGGCAGGTTATGCAGGCGCAGTTCTCGAGAACTGCGCCTGCATAACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014368.3-1469s21c1
Sequence:CCGGCAACTTCAGCTGATTACAATACTCGAGTATTGTAATCAGCTGAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014368.3-312s21c1
Sequence:CCGGCGAGATCCTGGACCGATATCTCTCGAGAGATATCGGTCCAGGATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)