EMAIL THIS PAGE TO A FRIEND

LHX8

LIM homeobox 8

113 Gene Product Result for
Synonyms: LHX7
UniProtKB ID: Q68G74, E9PGE3
Gene ID:
Human(431707) Summary: The protein encoded by this gene is a member of the LIM homeobox family of proteins, which are involved in patterning and differentiation of various tissue types. These proteins contain two tandemly repeated cysteine-rich double-zinc finger motifs known as LIM domains, in addition to a DNA-binding homeodomain. This family member is a transcription factor that plays a role in tooth morphogenesis. It is also involved in oogenesis and in neuronal differentiation. This gene is a candidate gene for cleft palate, and it is also associated with odontoma formation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(16875) LIM homeobox protein 8
Rat(365963) LIM homeobox 8
chicken(424721) LIM homeobox 8
domestic cat(101086738) LIM homeobox 8
dog(490209) LIM homeobox 8
cow(512385) LIM homeobox 8
sheep(101107567) LIM homeobox 8
naked mole-rat(101711612) LIM homeobox 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001933 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086861 MISSION® esiRNA esiRNA human LHX8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001933 Rosetta Predictions human pricing
NM_001012219 Rosetta Predictions rat pricing
NM_010713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032069 predicted 1184
2 SASI_Hs01_00032070 predicted 1380
3 SASI_Hs02_00304018 predicted 1621
4 SASI_Hs01_00032071 predicted 1375
5 SASI_Hs01_00032072 predicted 1121
6 SASI_Hs01_00032073 predicted 1743
7 SASI_Hs01_00032074 predicted 1348
8 SASI_Hs01_00032075 predicted 1439
9 SASI_Hs01_00032076 predicted 1456
10 SASI_Hs01_00032078 predicted 1203
11 SASI_Hs01_00032077 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099633 predicted 373
2 SASI_Rn01_00099634 predicted 741
3 SASI_Rn02_00200475 predicted 1025
4 SASI_Rn01_00099636 predicted 296
5 SASI_Rn01_00099637 predicted 1071
6 SASI_Rn01_00099638 predicted 678
7 SASI_Rn01_00099639 predicted 751
8 SASI_Rn01_00099640 predicted 631
9 SASI_Rn01_00099641 predicted 452
10 SASI_Rn01_00099642 predicted 634
11 SASI_Rn01_00099635 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198538 predicted 965
2 SASI_Mm01_00198540 predicted 893
3 SASI_Mm01_00198539 predicted 610
4 SASI_Mm01_00198542 predicted 520
5 SASI_Mm01_00198544 predicted 1066
6 SASI_Mm01_00198545 predicted 1042
7 SASI_Mm01_00198546 predicted 862
8 SASI_Mm01_00198547 predicted 911
9 SASI_Mm02_00319172 predicted 219
10 SASI_Mm02_00319173 predicted 209
11 SASI_Mm01_00198541 predicted 822
12 SASI_Mm01_00198543 predicted 716
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010713
LHX8 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-1188s21c1
Sequence:CCGGTGTTGGAAGAAATGGCTTATTCTCGAGAATAAGCCATTTCTTCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-710s1c1
Sequence:CCGGGAGCTGCTACATTAAGGATAACTCGAGTTATCCTTAATGTAGCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-747s1c1
Sequence:CCGGCTCGATTACTTCAGACGGTATCTCGAGATACCGTCTGAAGTAATCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-607s1c1
Sequence:CCGGGCCTGGAGATTGTGGACAAATCTCGAGATTTGTCCACAATCTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-1082s1c1
Sequence:CCGGCCAGGTTATGCAAGCACAGTTCTCGAGAACTGTGCTTGCATAACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-1285s1c1
Sequence:CCGGCCATCTTGGAAGAAATGGCTTCTCGAGAAGCCATTTCTTCCAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-867s21c1
Sequence:CCGGGAGAAGTGGAGAACGGTAATGCTCGAGCATTACCGTTCTCCACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-840s21c1
Sequence:CCGGTTGACTGCATGCTGGACAATCCTCGAGGATTGTCCAGCATGCAGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010713
LHX8 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-1188s21c1
Sequence:CCGGTGTTGGAAGAAATGGCTTATTCTCGAGAATAAGCCATTTCTTCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-710s1c1
Sequence:CCGGGAGCTGCTACATTAAGGATAACTCGAGTTATCCTTAATGTAGCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-747s1c1
Sequence:CCGGCTCGATTACTTCAGACGGTATCTCGAGATACCGTCTGAAGTAATCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-607s1c1
Sequence:CCGGGCCTGGAGATTGTGGACAAATCTCGAGATTTGTCCACAATCTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-1082s1c1
Sequence:CCGGCCAGGTTATGCAAGCACAGTTCTCGAGAACTGTGCTTGCATAACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-1285s1c1
Sequence:CCGGCCATCTTGGAAGAAATGGCTTCTCGAGAAGCCATTTCTTCCAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-867s21c1
Sequence:CCGGGAGAAGTGGAGAACGGTAATGCTCGAGCATTACCGTTCTCCACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-840s21c1
Sequence:CCGGTTGACTGCATGCTGGACAATCCTCGAGGATTGTCCAGCATGCAGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010713
LHX8 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-1188s21c1
Sequence:CCGGTGTTGGAAGAAATGGCTTATTCTCGAGAATAAGCCATTTCTTCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-710s1c1
Sequence:CCGGGAGCTGCTACATTAAGGATAACTCGAGTTATCCTTAATGTAGCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-747s1c1
Sequence:CCGGCTCGATTACTTCAGACGGTATCTCGAGATACCGTCTGAAGTAATCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-607s1c1
Sequence:CCGGGCCTGGAGATTGTGGACAAATCTCGAGATTTGTCCACAATCTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-1082s1c1
Sequence:CCGGCCAGGTTATGCAAGCACAGTTCTCGAGAACTGTGCTTGCATAACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010713.1-1285s1c1
Sequence:CCGGCCATCTTGGAAGAAATGGCTTCTCGAGAAGCCATTTCTTCCAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-867s21c1
Sequence:CCGGGAGAAGTGGAGAACGGTAATGCTCGAGCATTACCGTTCTCCACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010713.2-840s21c1
Sequence:CCGGTTGACTGCATGCTGGACAATCCTCGAGGATTGTCCAGCATGCAGTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001933
LHX8 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-876s1c1
Sequence:CCGGGCAAGTGTGTGTGCAACAGTTCTCGAGAACTGTTGCACACACACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001933.1-1865s1c1
Sequence:CCGGCCCAGGTATGTATCTATAGTTCTCGAGAACTATAGATACATACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1312s1c1
Sequence:CCGGGCAAGATGTTAACCATCCAAACTCGAGTTTGGATGGTTAACATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1373s1c1
Sequence:CCGGCTTCAGGTTATGCAAGCACAACTCGAGTTGTGCTTGCATAACCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1222s1c1
Sequence:CCGGCAGAGTACATTATGACTGCATCTCGAGATGCAGTCATAATGTACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001933
LHX8 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-876s1c1
Sequence:CCGGGCAAGTGTGTGTGCAACAGTTCTCGAGAACTGTTGCACACACACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001933.1-1865s1c1
Sequence:CCGGCCCAGGTATGTATCTATAGTTCTCGAGAACTATAGATACATACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1312s1c1
Sequence:CCGGGCAAGATGTTAACCATCCAAACTCGAGTTTGGATGGTTAACATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1373s1c1
Sequence:CCGGCTTCAGGTTATGCAAGCACAACTCGAGTTGTGCTTGCATAACCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1222s1c1
Sequence:CCGGCAGAGTACATTATGACTGCATCTCGAGATGCAGTCATAATGTACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001933
LHX8 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-876s1c1
Sequence:CCGGGCAAGTGTGTGTGCAACAGTTCTCGAGAACTGTTGCACACACACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038949    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001933.1-1865s1c1
Sequence:CCGGCCCAGGTATGTATCTATAGTTCTCGAGAACTATAGATACATACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1312s1c1
Sequence:CCGGGCAAGATGTTAACCATCCAAACTCGAGTTTGGATGGTTAACATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1373s1c1
Sequence:CCGGCTTCAGGTTATGCAAGCACAACTCGAGTTGTGCTTGCATAACCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001933.1-1222s1c1
Sequence:CCGGCAGAGTACATTATGACTGCATCTCGAGATGCAGTCATAATGTACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)