EMAIL THIS PAGE TO A FRIEND

LHX9

LIM homeobox 9

158 Gene Product Result for
Gene ID:
Human(56956) Summary: This gene encodes a member of the LIM homeobox gene family of developmentally expressed transcription factors. The encoded protein contains a homeodomain and two cysteine-rich zinc-binding LIM domains involved in protein-protein interactions. The protein is highly similar to a mouse protein that causes gonadal agenesis when inactivated, suggesting a role in gonadal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(16876) LIM homeobox protein 9
Rat(289048) LIM homeobox 9
Zebrafish(550405) LIM homeobox 9
dog(490257) LIM homeobox 9
cow(515012) LIM homeobox 9
Horse(100051569) LIM homeobox 9
domestic cat(101092908) LIM homeobox 9
chicken(396397) LIM homeobox 9
naked mole-rat(101711602) LIM homeobox 9
sheep(101101906) LIM homeobox 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020204 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014434 Rosetta Predictions human pricing
NM_020204 Rosetta Predictions human pricing
NM_181367 Rosetta Predictions rat pricing
NM_001025565 Rosetta Predictions mouse pricing
NM_001042577 Rosetta Predictions mouse pricing
NM_010714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014434 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199764 predicted 770
2 SASI_Hs01_00199766 predicted 632
3 SASI_Hs01_00199767 predicted 846
4 SASI_Hs01_00199768 predicted 412
5 SASI_Hs01_00199769 predicted 742
6 SASI_Hs01_00199770 predicted 332
7 SASI_Hs01_00199771 predicted 806
8 SASI_Hs01_00199772 predicted 709
9 SASI_Hs01_00199773 predicted 879
10 SASI_Hs02_00306539 predicted 719
11 SASI_Hs01_00199765 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183190 predicted 1206
2 SASI_Hs01_00183192 predicted 1064
3 SASI_Hs01_00183193 predicted 1281
4 SASI_Hs01_00183194 predicted 851
5 SASI_Hs01_00183195 predicted 1182
6 SASI_Hs01_00183196 predicted 773
7 SASI_Hs01_00183197 predicted 1243
8 SASI_Hs01_00183198 predicted 1147
9 SASI_Hs01_00183199 predicted 1317
10 SASI_Hs02_00353141 predicted 1152
11 SASI_Hs01_00183191 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067701 predicted 901
2 SASI_Rn02_00269696 predicted 924
3 SASI_Rn01_00067702 predicted 850
4 SASI_Rn01_00067703 predicted 377
5 SASI_Rn01_00067704 predicted 816
6 SASI_Rn01_00067705 predicted 506
7 SASI_Rn01_00067706 predicted 539
8 SASI_Rn01_00067707 predicted 428
9 SASI_Rn01_00067708 predicted 730
10 SASI_Rn02_00269697 predicted 554
11 SASI_Rn01_00067709 predicted 731
12 SASI_Rn01_00067710 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099151 predicted 918
2 SASI_Mm02_00287906 predicted 799
3 SASI_Mm02_00287907 predicted 817
4 SASI_Mm02_00287908 predicted 1171
5 SASI_Mm02_00287909 predicted 715
6 SASI_Mm02_00287910 predicted 1090
7 SASI_Mm02_00287911 predicted 745
8 SASI_Mm02_00287912 predicted 776
9 SASI_Mm02_00287913 predicted 868
10 SASI_Mm02_00287914 predicted 954
11 SASI_Mm01_00099148 predicted 1814
12 SASI_Mm01_00099149 predicted 1317
13 SASI_Mm01_00099150 predicted 1858
14 SASI_Mm01_00099152 predicted 1241
15 SASI_Mm01_00099153 predicted 1243
16 SASI_Mm01_00099154 predicted 744
17 SASI_Mm01_00099155 predicted 1188
18 SASI_Mm01_00099156 predicted 1805
19 SASI_Mm01_00099157 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290635 predicted 917
2 SASI_Mm02_00290636 predicted 797
3 SASI_Mm02_00290637 predicted 813
4 SASI_Mm02_00290638 predicted 1169
5 SASI_Mm02_00290639 predicted 714
6 SASI_Mm02_00290640 predicted 1093
7 SASI_Mm02_00290641 predicted 742
8 SASI_Mm02_00290642 predicted 781
9 SASI_Mm02_00290643 predicted 867
10 SASI_Mm02_00290644 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048306 predicted 545
2 SASI_Mm02_00319174 predicted 423
3 SASI_Mm02_00319175 predicted 440
4 SASI_Mm02_00319176 predicted 800
5 SASI_Mm02_00319177 predicted 346
6 SASI_Mm02_00319178 predicted 716
7 SASI_Mm02_00319179 predicted 372
8 SASI_Mm02_00319180 predicted 406
9 SASI_Mm02_00319181 predicted 496
10 SASI_Mm02_00319182 predicted 584
11 SASI_Mm01_00048303 predicted 1444
12 SASI_Mm01_00048304 predicted 945
13 SASI_Mm01_00048305 predicted 1487
14 SASI_Mm01_00048307 predicted 865
15 SASI_Mm01_00048308 predicted 868
16 SASI_Mm01_00048309 predicted 376
17 SASI_Mm01_00048310 predicted 814
18 SASI_Mm01_00048311 predicted 1435
19 SASI_Mm01_00048312 predicted 943
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010714
LHX9 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1429s21c1
Sequence:CCGGATCGAGCACCATAGCTGTAAACTCGAGTTTACAGCTATGGTGCTCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1490s21c1
Sequence:CCGGGTATCAGTCCTATCTGTTAATCTCGAGATTAACAGATAGGACTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010714.3-320s21c1
Sequence:CCGGAGATCTCCGACAGGTACTATCCTCGAGGATAGTACCTGTCGGAGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-927s1c1
Sequence:CCGGCGGACCATGAAATCCTACTTTCTCGAGAAAGTAGGATTTCATGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-948s1c1
Sequence:CCGGGCTATCAACCATAACCCAGATCTCGAGATCTGGGTTATGGTTGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-809s1c1
Sequence:CCGGGAATTACAACTCAGGTTGTAACTCGAGTTACAACCTGAGTTGTAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-559s1c1
Sequence:CCGGGCTGCTTCACTTGTTCCACTTCTCGAGAAGTGGAACAAGTGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-179s1c1
Sequence:CCGGCCAAGGTATCATGGAGGAGATCTCGAGATCTCCTCCATGATACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1140s21c1
Sequence:CCGGCACTATTAGGTTATGATAATCCTCGAGGATTATCATAACCTAATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010714
LHX9 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1429s21c1
Sequence:CCGGATCGAGCACCATAGCTGTAAACTCGAGTTTACAGCTATGGTGCTCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1490s21c1
Sequence:CCGGGTATCAGTCCTATCTGTTAATCTCGAGATTAACAGATAGGACTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010714.3-320s21c1
Sequence:CCGGAGATCTCCGACAGGTACTATCCTCGAGGATAGTACCTGTCGGAGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-927s1c1
Sequence:CCGGCGGACCATGAAATCCTACTTTCTCGAGAAAGTAGGATTTCATGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-948s1c1
Sequence:CCGGGCTATCAACCATAACCCAGATCTCGAGATCTGGGTTATGGTTGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-809s1c1
Sequence:CCGGGAATTACAACTCAGGTTGTAACTCGAGTTACAACCTGAGTTGTAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-559s1c1
Sequence:CCGGGCTGCTTCACTTGTTCCACTTCTCGAGAAGTGGAACAAGTGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-179s1c1
Sequence:CCGGCCAAGGTATCATGGAGGAGATCTCGAGATCTCCTCCATGATACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1140s21c1
Sequence:CCGGCACTATTAGGTTATGATAATCCTCGAGGATTATCATAACCTAATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010714
LHX9 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1429s21c1
Sequence:CCGGATCGAGCACCATAGCTGTAAACTCGAGTTTACAGCTATGGTGCTCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1490s21c1
Sequence:CCGGGTATCAGTCCTATCTGTTAATCTCGAGATTAACAGATAGGACTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010714.3-320s21c1
Sequence:CCGGAGATCTCCGACAGGTACTATCCTCGAGGATAGTACCTGTCGGAGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-927s1c1
Sequence:CCGGCGGACCATGAAATCCTACTTTCTCGAGAAAGTAGGATTTCATGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-948s1c1
Sequence:CCGGGCTATCAACCATAACCCAGATCTCGAGATCTGGGTTATGGTTGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-809s1c1
Sequence:CCGGGAATTACAACTCAGGTTGTAACTCGAGTTACAACCTGAGTTGTAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-559s1c1
Sequence:CCGGGCTGCTTCACTTGTTCCACTTCTCGAGAAGTGGAACAAGTGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010714.1-179s1c1
Sequence:CCGGCCAAGGTATCATGGAGGAGATCTCGAGATCTCCTCCATGATACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433659    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010714.3-1140s21c1
Sequence:CCGGCACTATTAGGTTATGATAATCCTCGAGGATTATCATAACCTAATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020204
LHX9 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020204.2-667s21c1
Sequence:CCGGAGATCTCGGACAGGTACTATCCTCGAGGATAGTACCTGTCCGAGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020204.2-2067s21c1
Sequence:CCGGGCAATTGTATGTGTGATTATGCTCGAGCATAATCACACATACAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1274s1c1
Sequence:CCGGCCGGACCATGAAATCCTACTTCTCGAGAAGTAGGATTTCATGGTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1395s1c1
Sequence:CCGGGCCAAATTCAGAAGGAACCTTCTCGAGAAGGTTCCTTCTGAATTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-796s1c1
Sequence:CCGGGCAAGGAGGATTACTACAGAACTCGAGTTCTGTAGTAATCCTCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1600s1c1
Sequence:CCGGCCTCACAAACTACCTTAACAACTCGAGTTGTTAAGGTAGTTTGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020204.2-773s21c1
Sequence:CCGGTGCCAAGGACGGTAGCATTTACTCGAGTAAATGCTACCGTCCTTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020204
LHX9 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020204.2-667s21c1
Sequence:CCGGAGATCTCGGACAGGTACTATCCTCGAGGATAGTACCTGTCCGAGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020204.2-2067s21c1
Sequence:CCGGGCAATTGTATGTGTGATTATGCTCGAGCATAATCACACATACAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1274s1c1
Sequence:CCGGCCGGACCATGAAATCCTACTTCTCGAGAAGTAGGATTTCATGGTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1395s1c1
Sequence:CCGGGCCAAATTCAGAAGGAACCTTCTCGAGAAGGTTCCTTCTGAATTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-796s1c1
Sequence:CCGGGCAAGGAGGATTACTACAGAACTCGAGTTCTGTAGTAATCCTCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1600s1c1
Sequence:CCGGCCTCACAAACTACCTTAACAACTCGAGTTGTTAAGGTAGTTTGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020204.2-773s21c1
Sequence:CCGGTGCCAAGGACGGTAGCATTTACTCGAGTAAATGCTACCGTCCTTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020204
LHX9 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020204.2-667s21c1
Sequence:CCGGAGATCTCGGACAGGTACTATCCTCGAGGATAGTACCTGTCCGAGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020204.2-2067s21c1
Sequence:CCGGGCAATTGTATGTGTGATTATGCTCGAGCATAATCACACATACAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1274s1c1
Sequence:CCGGCCGGACCATGAAATCCTACTTCTCGAGAAGTAGGATTTCATGGTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1395s1c1
Sequence:CCGGGCCAAATTCAGAAGGAACCTTCTCGAGAAGGTTCCTTCTGAATTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-796s1c1
Sequence:CCGGGCAAGGAGGATTACTACAGAACTCGAGTTCTGTAGTAATCCTCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020204.2-1600s1c1
Sequence:CCGGCCTCACAAACTACCTTAACAACTCGAGTTGTTAAGGTAGTTTGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020204.2-773s21c1
Sequence:CCGGTGCCAAGGACGGTAGCATTTACTCGAGTAAATGCTACCGTCCTTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)