EMAIL THIS PAGE TO A FRIEND

LIAS

lipoic acid synthetase

77 Gene Product Result for
Synonyms: LAS LIP1 LS PDHLD
UniProtKB ID: O43766, A8K873, Q8IV62
Gene ID:
Human(11019) Summary: The protein encoded by this gene belongs to the biotin and lipoic acid synthetases family. It localizes in mitochondrion and plays an important role in alpha-(+)-lipoic acid synthesis. It may also function in the sulfur insertion chemistry in lipoate biosynthesis. Alternative splicing occurs at this locus and two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(79464) lipoic acid synthetase
Rat(305348) lipoic acid synthetase
Zebrafish(393528) lipoic acid synthetase
dog(479108) lipoic acid synthetase
Horse(100055115) lipoic acid synthetase
cow(530865) lipoic acid synthetase
domestic cat(101083674) lipoic acid synthetase
chicken(422791) lipoic acid synthetase
sheep(101113851) lipoic acid synthetase
Domestic Rabbit(100352822) lipoic acid synthetase
domestic guinea pig(100734821) lipoic acid synthetase
naked mole-rat(101696506) lipoic acid synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006859 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071591 MISSION® esiRNA esiRNA human LIAS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006859 Rosetta Predictions human pricing
NM_194451 Rosetta Predictions human pricing
NM_001012037 Rosetta Predictions rat pricing
XM_573596 Rosetta Predictions rat pricing
NM_024471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166245 predicted 385
2 SASI_Hs01_00166246 predicted 552
3 SASI_Hs02_00342472 predicted 748
4 SASI_Hs01_00166247 predicted 451
5 SASI_Hs01_00166249 predicted 608
6 SASI_Hs01_00166250 predicted 789
7 SASI_Hs02_00342473 predicted 649
8 SASI_Hs01_00166251 predicted 578
9 SASI_Hs01_00166252 predicted 463
10 SASI_Hs02_00342474 predicted 717
11 SASI_Hs01_00166244 predicted 666
12 SASI_Hs01_00166248 predicted 765
13 SASI_Hs01_00166253 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151483 predicted 391
2 SASI_Hs01_00151484 predicted 552
3 SASI_Hs02_00371527 predicted 746
4 SASI_Hs01_00151485 predicted 455
5 SASI_Hs01_00151487 predicted 609
6 SASI_Hs01_00151488 predicted 790
7 SASI_Hs02_00371528 predicted 647
8 SASI_Hs01_00151489 predicted 577
9 SASI_Hs01_00151490 predicted 462
10 SASI_Hs02_00371529 predicted 721
11 SASI_Hs01_00151482 predicted 664
12 SASI_Hs01_00151486 predicted 760
13 SASI_Hs01_00151491 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106692 predicted 1094
2 SASI_Rn01_00106693 predicted 967
3 SASI_Rn01_00106694 predicted 260
4 SASI_Rn01_00106696 predicted 1001
5 SASI_Rn01_00106697 predicted 707
6 SASI_Rn01_00106698 predicted 296
7 SASI_Rn01_00106699 predicted 1043
8 SASI_Rn02_00200134 predicted 1074
9 SASI_Rn01_00106700 predicted 1011
10 SASI_Rn02_00200135 predicted 233
11 SASI_Rn01_00106691 predicted 745
12 SASI_Rn01_00106695 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182634 predicted 652
2 SASI_Rn01_00182635 predicted 498
3 SASI_Rn01_00182636 predicted 262
4 SASI_Rn01_00182637 predicted 743
5 SASI_Rn01_00182638 predicted 631
6 SASI_Rn01_00182639 predicted 544
7 SASI_Rn01_00182640 predicted 595
8 SASI_Rn01_00182641 predicted 287
9 SASI_Rn01_00182642 predicted 718
10 SASI_Rn01_00182643 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070533 predicted 1168
2 SASI_Mm01_00070534 predicted 1129
3 SASI_Mm01_00070535 predicted 555
4 SASI_Mm01_00070536 predicted 1141
5 SASI_Mm01_00070537 predicted 1102
6 SASI_Mm01_00070538 predicted 1073
7 SASI_Mm01_00070539 predicted 203
8 SASI_Mm01_00070540 predicted 366
9 SASI_Mm01_00070541 predicted 1060
10 SASI_Mm01_00070542 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006859
VALIDATED
LIAS MISSION shRNA Bacterial Glycerol Stock
lipoic acid synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-1344s1c1
Sequence:CCGGGCCTGTAATCCCAGCACTTTACTCGAGTAAAGTGCTGGGATTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-979s1c2
Sequence:CCGGCTGCTTGACTTTAGGACAATACTCGAGTATTGTCCTAAAGTCAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-115s21c1
Sequence:CCGGCCGGGTATTTGGGAGATATTTCTCGAGAAATATCTCCCAAATACCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-722s1c1
Sequence:CCGGCGAGGTGATCTCAAAGCAATACTCGAGTATTGCTTTGAGATCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-981s1c1
Sequence:CCGGGCTTGACTTTAGGACAATATACTCGAGTATATTGTCCTAAAGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006859.2-552s1c1
Sequence:CCGGCCTACAATACTGCAAAGGCAACTCGAGTTGCCTTTGCAGTATTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-817s21c1
Sequence:CCGGTCGTGATCCTCGGGCCAATTTCTCGAGAAATTGGCCCGAGGATCACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-650s21c1
Sequence:GTACCGGATTGCAAAGACCGTATCATATCTCGAGATATGATACGGTCTTTGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006859.2-1204s21c1
Sequence:GTACCGGGACCTTCAAGATCACAGAAATCTCGAGATTTCTGTGATCTTGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-540s21c1
Sequence:CCGGATGCCAGTGAGCCCTACAATACTCGAGTATTGTAGGGCTCACTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006859
VALIDATED
LIAS MISSION shRNA shRNA Plasmid DNA
lipoic acid synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-1344s1c1
Sequence:CCGGGCCTGTAATCCCAGCACTTTACTCGAGTAAAGTGCTGGGATTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-979s1c2
Sequence:CCGGCTGCTTGACTTTAGGACAATACTCGAGTATTGTCCTAAAGTCAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-115s21c1
Sequence:CCGGCCGGGTATTTGGGAGATATTTCTCGAGAAATATCTCCCAAATACCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-722s1c1
Sequence:CCGGCGAGGTGATCTCAAAGCAATACTCGAGTATTGCTTTGAGATCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-981s1c1
Sequence:CCGGGCTTGACTTTAGGACAATATACTCGAGTATATTGTCCTAAAGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006859.2-552s1c1
Sequence:CCGGCCTACAATACTGCAAAGGCAACTCGAGTTGCCTTTGCAGTATTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-817s21c1
Sequence:CCGGTCGTGATCCTCGGGCCAATTTCTCGAGAAATTGGCCCGAGGATCACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-650s21c1
Sequence:GTACCGGATTGCAAAGACCGTATCATATCTCGAGATATGATACGGTCTTTGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006859.2-1204s21c1
Sequence:GTACCGGGACCTTCAAGATCACAGAAATCTCGAGATTTCTGTGATCTTGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-540s21c1
Sequence:CCGGATGCCAGTGAGCCCTACAATACTCGAGTATTGTAGGGCTCACTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006859
VALIDATED
LIAS MISSION shRNA Lentiviral Transduction Particles
lipoic acid synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-1344s1c1
Sequence:CCGGGCCTGTAATCCCAGCACTTTACTCGAGTAAAGTGCTGGGATTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-979s1c2
Sequence:CCGGCTGCTTGACTTTAGGACAATACTCGAGTATTGTCCTAAAGTCAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-115s21c1
Sequence:CCGGCCGGGTATTTGGGAGATATTTCTCGAGAAATATCTCCCAAATACCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-722s1c1
Sequence:CCGGCGAGGTGATCTCAAAGCAATACTCGAGTATTGCTTTGAGATCACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_006859.2-981s1c1
Sequence:CCGGGCTTGACTTTAGGACAATATACTCGAGTATATTGTCCTAAAGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006859.2-552s1c1
Sequence:CCGGCCTACAATACTGCAAAGGCAACTCGAGTTGCCTTTGCAGTATTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-817s21c1
Sequence:CCGGTCGTGATCCTCGGGCCAATTTCTCGAGAAATTGGCCCGAGGATCACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-650s21c1
Sequence:GTACCGGATTGCAAAGACCGTATCATATCTCGAGATATGATACGGTCTTTGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006859.2-1204s21c1
Sequence:GTACCGGGACCTTCAAGATCACAGAAATCTCGAGATTTCTGTGATCTTGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006859.2-540s21c1
Sequence:CCGGATGCCAGTGAGCCCTACAATACTCGAGTATTGTAGGGCTCACTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024471
LIAS MISSION shRNA Bacterial Glycerol Stock
lipoic acid synthetase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024471.4-1476s21c1
Sequence:CCGGCGACACACATTTAGTGATAATCTCGAGATTATCACTAAATGTGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024471.2-1477s1c1
Sequence:CCGGCGACACACATTTAGTGATAATCTCGAGATTATCACTAAATGTGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-1182s1c1
Sequence:CCGGCTTCATATAAAGCAGGTGAATCTCGAGATTCACCTGCTTTATATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-198s1c1
Sequence:CCGGTCACGGTTAGAGCATTAAGTTCTCGAGAACTTAATGCTCTAACCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-1074s1c1
Sequence:CCGGGCCACCTTAAGGTTGAAGAATCTCGAGATTCTTCAACCTTAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-200s21c1
Sequence:CCGGCGGTTAGAGCATTAAGTTCTTCTCGAGAAGAACTTAATGCTCTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-1073s21c1
Sequence:CCGGGCCACCTTAAGGTTGAAGAATCTCGAGATTCTTCAACCTTAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-1181s21c1
Sequence:CCGGCTTCATATAAAGCAGGTGAATCTCGAGATTCACCTGCTTTATATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024471
LIAS MISSION shRNA shRNA Plasmid DNA
lipoic acid synthetase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024471.4-1476s21c1
Sequence:CCGGCGACACACATTTAGTGATAATCTCGAGATTATCACTAAATGTGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024471.2-1477s1c1
Sequence:CCGGCGACACACATTTAGTGATAATCTCGAGATTATCACTAAATGTGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-1182s1c1
Sequence:CCGGCTTCATATAAAGCAGGTGAATCTCGAGATTCACCTGCTTTATATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-198s1c1
Sequence:CCGGTCACGGTTAGAGCATTAAGTTCTCGAGAACTTAATGCTCTAACCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-1074s1c1
Sequence:CCGGGCCACCTTAAGGTTGAAGAATCTCGAGATTCTTCAACCTTAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-200s21c1
Sequence:CCGGCGGTTAGAGCATTAAGTTCTTCTCGAGAAGAACTTAATGCTCTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-1073s21c1
Sequence:CCGGGCCACCTTAAGGTTGAAGAATCTCGAGATTCTTCAACCTTAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-1181s21c1
Sequence:CCGGCTTCATATAAAGCAGGTGAATCTCGAGATTCACCTGCTTTATATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024471
LIAS MISSION shRNA Lentiviral Transduction Particles
lipoic acid synthetase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024471.4-1476s21c1
Sequence:CCGGCGACACACATTTAGTGATAATCTCGAGATTATCACTAAATGTGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024471.2-1477s1c1
Sequence:CCGGCGACACACATTTAGTGATAATCTCGAGATTATCACTAAATGTGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-1182s1c1
Sequence:CCGGCTTCATATAAAGCAGGTGAATCTCGAGATTCACCTGCTTTATATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-198s1c1
Sequence:CCGGTCACGGTTAGAGCATTAAGTTCTCGAGAACTTAATGCTCTAACCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024471.2-1074s1c1
Sequence:CCGGGCCACCTTAAGGTTGAAGAATCTCGAGATTCTTCAACCTTAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-200s21c1
Sequence:CCGGCGGTTAGAGCATTAAGTTCTTCTCGAGAAGAACTTAATGCTCTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-1073s21c1
Sequence:CCGGGCCACCTTAAGGTTGAAGAATCTCGAGATTCTTCAACCTTAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024471.4-1181s21c1
Sequence:CCGGCTTCATATAAAGCAGGTGAATCTCGAGATTCACCTGCTTTATATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)