EMAIL THIS PAGE TO A FRIEND

LIF

leukemia inhibitory factor

155 Gene Product Result for
Synonyms: CDF DIA HILDA MLPLI
UniProtKB ID: P15018, B2RCW7, B5MC23, Q52LZ2
Gene ID:
Human(3976) Summary: The protein encoded by this gene is a pleiotropic cytokine with roles in several different systems. It is involved in the induction of hematopoietic differentiation in normal and myeloid leukemia cells, induction of neuronal cell differentiation, regulator of mesenchymal to epithelial conversion during kidney development, and may also have a role in immune tolerance at the maternal-fetal interface. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Mouse(16878) leukemia inhibitory factor
Rat(60584) leukemia inhibitory factor
chicken(427718) leukemia inhibitory factor
dog(403449) leukemia inhibitory factor (cholinergic differentiation factor)
cow(280840) leukemia inhibitory factor (cholinergic differentiation factor)
domestic cat(101090296) leukemia inhibitory factor
domestic guinea pig(100713602) leukemia inhibitory factor
naked mole-rat(101713065) leukemia inhibitory factor
sheep(101110180) leukemia inhibitory factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
L9152 Anti-Leukemia Inhibitory Factor antibody produced in goat IgG fraction of antiserum, lyophilized powder mouse
immunohistochemistry, neutralization, western blot pricing
L9277 Anti-Leukemia Inhibitory Factor antibody produced in goat IgG fraction of antiserum, lyophilized powder human
neutralization pricing
L1044 Anti-Leukemia Inhibitory Factor antibody produced in goat affinity isolated antibody, lyophilized powder mouse
neutralization, western blot pricing
L1169 Anti-Leukemia Inhibitory Factor antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
SAB2502145 Anti-LIF antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
SAB1406083 Anti-LIF antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA018844 Anti-LIF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2101344 Anti-LIF antibody produced in rabbit affinity isolated antibody bovine, horse, canine, rabbit, mouse, rat, human, guinea pig, pig, sheep
western blot pricing
L0669 Monoclonal Anti-Leukemia Inhibitory Factor antibody produced in mouse clone 9824, purified immunoglobulin, lyophilized powder human
ELISA, immunohistochemistry, neutralization, western blot pricing
L0919 Monoclonal Anti-Leukemia Inhibitory Factor antibody produced in mouse clone 9808, purified immunoglobulin, lyophilized powder human
flow cytometry, western blot pricing
L0544 Monoclonal Anti-Leukemia Inhibitory Factor antibody produced in rat clone 139124, purified immunoglobulin, lyophilized powder mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002309 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026101 MISSION® esiRNA esiRNA human LIF (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MAB4306 Anti-Human Leukemia Inhibitory Factor Antibody, clone 4F7.2 Detect Human Leukemia Inhibitory Factor using this Anti-Human Leukemia Inhibitory Factor Antibody, clone 4F7.2 validated for use in ELISA & WB. pricing
MAB4307 Anti-Mouse Leukemia Inhibitory Factor Antibody, clone 2H2.2 Anti-Mouse Leukemia Inhibitory Factor Antibody, clone 2H2.2 is an antibody against Mouse Leukemia Inhibitory Factor for use in ELISA & WB. pricing
ESG1106 ESGRO® Recombinant Mouse LIF Protein ESGRO Leukemia Inhibitory Factor (LIF) supplement for mouse ES cell culture. Each vial contains 10^6 units/ml pricing
ESG1107 ESGRO® Recombinant Mouse LIF Protein ESGRO Leukemia Inhibitory Factor (LIF) supplement for mouse ES cell culture. Each vial contains 10^7 units/ml. pricing
LIF1010 Leukemia Inhibitory Factor Protein, Recombinant human Recombinant human Leukemia Inhibitory Factor (LIF) protein is biologically active and suitable for cell culture applications. pricing
LIF1005 Leukemia Inhibitory Factor Protein, Recombinant human - 5 µg Recombinant human Leukemia Inhibitory Factor (LIF) protein is biologically active and suitable for cell culture applications. pricing
LIF20 Leukemia Inhibitory Factor Protein, Recombinant mouse - 5 µg Recombinant mouse Leukemia Inhibitory Factor (LIF) protein is biologically active and suitable for cell culture applications. pricing
LIF2005 Leukemia Inhibitory Factor Protein, Recombinant mouse - 5 µg Recombinant mouse Leukemia Inhibitory Factor (LIF) protein is biologically active and suitable for cell culture applications. pricing
LIF1050 Leukemia Inhibitory Factor, recombinant human Recombinant human Leukemia Inhibitory Factor (LIF) protein is biologically active and suitable for cell culture applications. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002309 Rosetta Predictions human pricing
NM_022196 Rosetta Predictions rat pricing
NM_001039537 Rosetta Predictions mouse pricing
NM_008501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130401 predicted 63
2 SASI_Hs01_00130402 predicted 233
3 SASI_Hs01_00130403 predicted 220
4 SASI_Hs01_00130404 predicted 231
5 SASI_Hs01_00130405 predicted 575
6 SASI_Hs01_00130406 predicted 236
7 SASI_Hs01_00130407 predicted 177
8 SASI_Hs01_00130409 predicted 543
9 SASI_Hs01_00130410 predicted 865
10 SASI_Hs02_00333625 predicted 192
11 SASI_Hs01_00130408 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083481 predicted 379
2 SASI_Rn01_00083483 predicted 382
3 SASI_Rn02_00262940 predicted 255
4 SASI_Rn02_00262941 predicted 348
5 SASI_Rn01_00083482 predicted 219
6 SASI_Rn02_00262942 predicted 383
7 SASI_Rn02_00262943 predicted 232
8 SASI_Rn02_00262944 predicted 243
9 SASI_Rn02_00262945 predicted 254
10 SASI_Rn02_00262946 predicted 224
11 SASI_Rn01_00083484 predicted 244
12 SASI_Rn01_00083485 predicted 236
13 SASI_Rn01_00083486 predicted 305
14 SASI_Rn01_00083487 predicted 231
15 SASI_Rn01_00083488 predicted 259
16 SASI_Rn01_00083489 predicted 393
17 SASI_Rn01_00083490 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184650 predicted 304
2 SASI_Mm01_00184651 predicted 523
3 SASI_Mm01_00184652 predicted 249
4 SASI_Mm02_00290124 predicted 617
5 SASI_Mm01_00184653 predicted 566
6 SASI_Mm01_00184654 predicted 181
7 SASI_Mm01_00184655 predicted 181
8 SASI_Mm01_00184656 predicted 164
9 SASI_Mm01_00184657 predicted 407
10 SASI_Mm01_00184658 predicted 779
11 SASI_Mm01_00184659 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137539 predicted 736
2 SASI_Mm01_00137540 predicted 462
3 SASI_Mm02_00314056 predicted 841
4 SASI_Mm01_00137541 predicted 519
5 SASI_Mm01_00137542 predicted 994
6 SASI_Mm01_00137544 predicted 994
7 SASI_Mm01_00137545 predicted 1271
8 SASI_Mm01_00137546 predicted 357
9 SASI_Mm01_00137547 predicted 1170
10 SASI_Mm01_00137548 predicted 964
11 SASI_Mm01_00137543 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008501
VALIDATED
LIF MISSION shRNA Bacterial Glycerol Stock
leukemia inhibitory factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-347s1c1
Sequence:CCGGGCGCCAATGCTCTCTTCATTTCTCGAGAAATGAAGAGAGCATTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008501.1-692s1c1
Sequence:CCGGCTGACAAAGAAGCCTTCCAAACTCGAGTTTGGAAGGCTTCTTTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-577s1c1
Sequence:CCGGGTCAAGCTCAATGCTACTATACTCGAGTATAGTAGCATTGAGCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-750s1c1
Sequence:CCGGGCAAGTCATAAGTGTGGTGGTCTCGAGACCACCACACTTATGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-429s1c1
Sequence:CCGGCATGACAGACTTCCCATCTTTCTCGAGAAAGATGGGAAGTCTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-481s21c1
Sequence:CCGGCATGACAGACTTCCCATCTTTCTCGAGAAAGATGGGAAGTCTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-792s21c1
Sequence:CCGGGGACATACAAGCAAGTCATAACTCGAGTTATGACTTGCTTGTATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-399s21c1
Sequence:CCGGGCGCCAATGCTCTCTTCATTTCTCGAGAAATGAAGAGAGCATTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-630s21c1
Sequence:CCGGTCAAGCTCAATGCTACTATAGCTCGAGCTATAGTAGCATTGAGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008501.2-1029s21c1
Sequence:CCGGTCCATAGGCAGAGCTTCTATACTCGAGTATAGAAGCTCTGCCTATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008501
VALIDATED
LIF MISSION shRNA shRNA Plasmid DNA
leukemia inhibitory factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-347s1c1
Sequence:CCGGGCGCCAATGCTCTCTTCATTTCTCGAGAAATGAAGAGAGCATTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008501.1-692s1c1
Sequence:CCGGCTGACAAAGAAGCCTTCCAAACTCGAGTTTGGAAGGCTTCTTTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-577s1c1
Sequence:CCGGGTCAAGCTCAATGCTACTATACTCGAGTATAGTAGCATTGAGCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-750s1c1
Sequence:CCGGGCAAGTCATAAGTGTGGTGGTCTCGAGACCACCACACTTATGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-429s1c1
Sequence:CCGGCATGACAGACTTCCCATCTTTCTCGAGAAAGATGGGAAGTCTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-481s21c1
Sequence:CCGGCATGACAGACTTCCCATCTTTCTCGAGAAAGATGGGAAGTCTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-792s21c1
Sequence:CCGGGGACATACAAGCAAGTCATAACTCGAGTTATGACTTGCTTGTATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-399s21c1
Sequence:CCGGGCGCCAATGCTCTCTTCATTTCTCGAGAAATGAAGAGAGCATTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-630s21c1
Sequence:CCGGTCAAGCTCAATGCTACTATAGCTCGAGCTATAGTAGCATTGAGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008501.2-1029s21c1
Sequence:CCGGTCCATAGGCAGAGCTTCTATACTCGAGTATAGAAGCTCTGCCTATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008501
VALIDATED
LIF MISSION shRNA Lentiviral Transduction Particles
leukemia inhibitory factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-347s1c1
Sequence:CCGGGCGCCAATGCTCTCTTCATTTCTCGAGAAATGAAGAGAGCATTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008501.1-692s1c1
Sequence:CCGGCTGACAAAGAAGCCTTCCAAACTCGAGTTTGGAAGGCTTCTTTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-577s1c1
Sequence:CCGGGTCAAGCTCAATGCTACTATACTCGAGTATAGTAGCATTGAGCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-750s1c1
Sequence:CCGGGCAAGTCATAAGTGTGGTGGTCTCGAGACCACCACACTTATGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008501.1-429s1c1
Sequence:CCGGCATGACAGACTTCCCATCTTTCTCGAGAAAGATGGGAAGTCTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-481s21c1
Sequence:CCGGCATGACAGACTTCCCATCTTTCTCGAGAAAGATGGGAAGTCTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-792s21c1
Sequence:CCGGGGACATACAAGCAAGTCATAACTCGAGTTATGACTTGCTTGTATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-399s21c1
Sequence:CCGGGCGCCAATGCTCTCTTCATTTCTCGAGAAATGAAGAGAGCATTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008501.2-630s21c1
Sequence:CCGGTCAAGCTCAATGCTACTATAGCTCGAGCTATAGTAGCATTGAGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008501.2-1029s21c1
Sequence:CCGGTCCATAGGCAGAGCTTCTATACTCGAGTATAGAAGCTCTGCCTATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002309
VALIDATED
LIF MISSION shRNA Bacterial Glycerol Stock
leukemia inhibitory factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002309.2-162s1c1
Sequence:CCGGCCTGTGCCATACGCCACCCATCTCGAGATGGGTGGCGTATGGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-234s1c1
Sequence:CCGGGCAGTGCCAATGCCCTCTTTACTCGAGTAAAGAGGGCATTGGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-178s1c1
Sequence:CCGGCCCATGTCACAACAACCTCATCTCGAGATGAGGTTGTTGTGACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-568s1c1
Sequence:CCGGCGGCCCTGACACCTCGGGTAACTCGAGTTACCCGAGGTGTCAGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002309.2-637s1c1
Sequence:CCGGTAAGCAGATCATCGCCGTGTTCTCGAGAACACGGCGATGATCTGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-210s21c1
Sequence:CCGGCCTGTGCCATACGCCACCCATCTCGAGATGGGTGGCGTATGGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-715s21c1
Sequence:CCGGCTTCTAGCAGGAGGTCTTGAACTCGAGTTCAAGACCTCCTGCTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-337s21c1
Sequence:CCGGCAACAACCTGGACAAGCTATGCTCGAGCATAGCTTGTCCAGGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-429s21c1
Sequence:CCGGACCGCATAGTCGTGTACCTTGCTCGAGCAAGGTACACGACTATGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002309
VALIDATED
LIF MISSION shRNA shRNA Plasmid DNA
leukemia inhibitory factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002309.2-162s1c1
Sequence:CCGGCCTGTGCCATACGCCACCCATCTCGAGATGGGTGGCGTATGGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-234s1c1
Sequence:CCGGGCAGTGCCAATGCCCTCTTTACTCGAGTAAAGAGGGCATTGGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-178s1c1
Sequence:CCGGCCCATGTCACAACAACCTCATCTCGAGATGAGGTTGTTGTGACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-568s1c1
Sequence:CCGGCGGCCCTGACACCTCGGGTAACTCGAGTTACCCGAGGTGTCAGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002309.2-637s1c1
Sequence:CCGGTAAGCAGATCATCGCCGTGTTCTCGAGAACACGGCGATGATCTGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-210s21c1
Sequence:CCGGCCTGTGCCATACGCCACCCATCTCGAGATGGGTGGCGTATGGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-715s21c1
Sequence:CCGGCTTCTAGCAGGAGGTCTTGAACTCGAGTTCAAGACCTCCTGCTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-337s21c1
Sequence:CCGGCAACAACCTGGACAAGCTATGCTCGAGCATAGCTTGTCCAGGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-429s21c1
Sequence:CCGGACCGCATAGTCGTGTACCTTGCTCGAGCAAGGTACACGACTATGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002309
VALIDATED
LIF MISSION shRNA Lentiviral Transduction Particles
leukemia inhibitory factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002309.2-162s1c1
Sequence:CCGGCCTGTGCCATACGCCACCCATCTCGAGATGGGTGGCGTATGGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-234s1c1
Sequence:CCGGGCAGTGCCAATGCCCTCTTTACTCGAGTAAAGAGGGCATTGGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-178s1c1
Sequence:CCGGCCCATGTCACAACAACCTCATCTCGAGATGAGGTTGTTGTGACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002309.2-568s1c1
Sequence:CCGGCGGCCCTGACACCTCGGGTAACTCGAGTTACCCGAGGTGTCAGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_002309.2-637s1c1
Sequence:CCGGTAAGCAGATCATCGCCGTGTTCTCGAGAACACGGCGATGATCTGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-210s21c1
Sequence:CCGGCCTGTGCCATACGCCACCCATCTCGAGATGGGTGGCGTATGGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-715s21c1
Sequence:CCGGCTTCTAGCAGGAGGTCTTGAACTCGAGTTCAAGACCTCCTGCTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-337s21c1
Sequence:CCGGCAACAACCTGGACAAGCTATGCTCGAGCATAGCTTGTCCAGGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002309.3-429s21c1
Sequence:CCGGACCGCATAGTCGTGTACCTTGCTCGAGCAAGGTACACGACTATGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)