EMAIL THIS PAGE TO A FRIEND

LIFR

leukemia inhibitory factor receptor alpha

212 Gene Product Result for
Synonyms: CD118 LIF-R SJS2 STWS SWS
UniProtKB ID: P42702, Q6LCD9
Gene ID:
Human(3977) Summary: This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16880) leukemia inhibitory factor receptor
Rat(81680) leukemia inhibitory factor receptor alpha
sheep(101106364) leukemia inhibitory factor receptor alpha
Domestic Rabbit(100303762) leukemia inhibitory factor receptor alpha
domestic guinea pig(100716454) leukemia inhibitory factor receptor alpha
naked mole-rat(101696861) leukemia inhibitory factor receptor alpha
chicken(395262) leukemia inhibitory factor receptor alpha
dog(449478) leukemia inhibitory factor receptor alpha
cow(539504) leukemia inhibitory factor receptor alpha
domestic cat(101097206) leukemia inhibitory factor receptor alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002310 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127671 Rosetta Predictions human pricing
NM_002310 Rosetta Predictions human pricing
NM_031048 Rosetta Predictions rat pricing
NM_001113386 Rosetta Predictions mouse pricing
NM_013584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330114 predicted 1329
2 SASI_Hs02_00330115 predicted 1217
3 SASI_Hs02_00330116 predicted 1490
4 SASI_Hs02_00330117 predicted 1329
5 SASI_Hs02_00330118 predicted 3616
6 SASI_Hs02_00330119 predicted 2400
7 SASI_Hs02_00330120 predicted 730
8 SASI_Hs02_00330121 predicted 3510
9 SASI_Hs02_00330122 predicted 2191
10 SASI_Hs02_00330123 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083951 predicted 1164
2 SASI_Hs01_00083952 predicted 1048
3 SASI_Hs01_00083953 predicted 1329
4 SASI_Hs02_00333626 predicted 1156
5 SASI_Hs01_00083954 predicted 3445
6 SASI_Hs02_00333627 predicted 2236
7 SASI_Hs01_00083955 predicted 566
8 SASI_Hs01_00083956 predicted 3338
9 SASI_Hs01_00083958 predicted 2020
10 SASI_Hs01_00083959 predicted 1606
11 SASI_Hs01_00083950 predicted 2756
12 SASI_Hs01_00083957 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031048 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099727 predicted 732
2 SASI_Rn01_00099728 predicted 879
3 SASI_Rn01_00099729 predicted 3144
4 SASI_Rn01_00099730 predicted 1603
5 SASI_Rn01_00099731 predicted 757
6 SASI_Rn01_00099732 predicted 1949
7 SASI_Rn01_00099733 predicted 363
8 SASI_Rn01_00099734 predicted 1401
9 SASI_Rn01_00099735 predicted 1902
10 SASI_Rn01_00099736 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307628 predicted 2069
2 SASI_Mm02_00307629 predicted 1681
3 SASI_Mm02_00307630 predicted 763
4 SASI_Mm02_00307631 predicted 1497
5 SASI_Mm02_00307632 predicted 1545
6 SASI_Mm02_00307633 predicted 1239
7 SASI_Mm02_00307634 predicted 2270
8 SASI_Mm02_00307635 predicted 1912
9 SASI_Mm02_00307636 predicted 1531
10 SASI_Mm02_00307637 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322322 predicted 1713
2 SASI_Mm01_00195426 predicted 1334
3 SASI_Mm01_00195428 predicted 407
4 SASI_Mm02_00322323 predicted 1145
5 SASI_Mm01_00195430 predicted 1192
6 SASI_Mm01_00195431 predicted 890
7 SASI_Mm02_00322324 predicted 1922
8 SASI_Mm01_00195432 predicted 1563
9 SASI_Mm01_00195433 predicted 1179
10 SASI_Mm02_00322325 predicted 719
11 SASI_Mm01_00195425 predicted 2026
12 SASI_Mm01_00195427 predicted 2314
13 SASI_Mm01_00195429 predicted 2444
14 SASI_Mm01_00195434 predicted 3120
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002310
VALIDATED
LIFR MISSION shRNA Bacterial Glycerol Stock
leukemia inhibitory factor receptor alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-2367s21c1
Sequence:CCGGACTTCTGCAGATTCGATATTACTCGAGTAATATCGAATCTGCAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-2122s21c1
Sequence:CCGGTGACTTGCGACTACGTCATTACTCGAGTAATGACGTAGTCGCAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-951s21c1
Sequence:CCGGGTAGGCTCAGACATAACATTTCTCGAGAAATGTTATGTCTGAGCCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-322s21c1
Sequence:CCGGTGAAGTGTGTAACTAACAATTCTCGAGAATTGTTAGTTACACACTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002310.2-2320s1c1
Sequence:CCGGGCTCCCATTGTTGCACCAAATCTCGAGATTTGGTGCAACAATGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-770s1c1
Sequence:CCGGCCTCAGATATGCCCTTGGAATCTCGAGATTCCAAGGGCATATCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-3335s1c1
Sequence:CCGGGCTCCATTAATTCCCGACAATCTCGAGATTGTCGGGAATTAATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002310.2-1862s1c1
Sequence:CCGGCCTACAATGTATCGTGTTCATCTCGAGATGAACACGATACATTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-3004s1c1
Sequence:CCGGCCACCCATCATTGAGGAAGAACTCGAGTTCTTCCTCAATGATGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002310
VALIDATED
LIFR MISSION shRNA shRNA Plasmid DNA
leukemia inhibitory factor receptor alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-2367s21c1
Sequence:CCGGACTTCTGCAGATTCGATATTACTCGAGTAATATCGAATCTGCAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-2122s21c1
Sequence:CCGGTGACTTGCGACTACGTCATTACTCGAGTAATGACGTAGTCGCAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-951s21c1
Sequence:CCGGGTAGGCTCAGACATAACATTTCTCGAGAAATGTTATGTCTGAGCCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-322s21c1
Sequence:CCGGTGAAGTGTGTAACTAACAATTCTCGAGAATTGTTAGTTACACACTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002310.2-2320s1c1
Sequence:CCGGGCTCCCATTGTTGCACCAAATCTCGAGATTTGGTGCAACAATGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-770s1c1
Sequence:CCGGCCTCAGATATGCCCTTGGAATCTCGAGATTCCAAGGGCATATCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-3335s1c1
Sequence:CCGGGCTCCATTAATTCCCGACAATCTCGAGATTGTCGGGAATTAATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002310.2-1862s1c1
Sequence:CCGGCCTACAATGTATCGTGTTCATCTCGAGATGAACACGATACATTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-3004s1c1
Sequence:CCGGCCACCCATCATTGAGGAAGAACTCGAGTTCTTCCTCAATGATGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002310
VALIDATED
LIFR MISSION shRNA Lentiviral Transduction Particles
leukemia inhibitory factor receptor alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-2367s21c1
Sequence:CCGGACTTCTGCAGATTCGATATTACTCGAGTAATATCGAATCTGCAGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-2122s21c1
Sequence:CCGGTGACTTGCGACTACGTCATTACTCGAGTAATGACGTAGTCGCAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-951s21c1
Sequence:CCGGGTAGGCTCAGACATAACATTTCTCGAGAAATGTTATGTCTGAGCCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002310.5-322s21c1
Sequence:CCGGTGAAGTGTGTAACTAACAATTCTCGAGAATTGTTAGTTACACACTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002310.2-2320s1c1
Sequence:CCGGGCTCCCATTGTTGCACCAAATCTCGAGATTTGGTGCAACAATGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-770s1c1
Sequence:CCGGCCTCAGATATGCCCTTGGAATCTCGAGATTCCAAGGGCATATCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-3335s1c1
Sequence:CCGGGCTCCATTAATTCCCGACAATCTCGAGATTGTCGGGAATTAATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002310.2-1862s1c1
Sequence:CCGGCCTACAATGTATCGTGTTCATCTCGAGATGAACACGATACATTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002310.2-3004s1c1
Sequence:CCGGCCACCCATCATTGAGGAAGAACTCGAGTTCTTCCTCAATGATGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013584
VALIDATED
LIFR MISSION shRNA Bacterial Glycerol Stock
leukemia inhibitory factor receptor alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-1836s1c1
Sequence:CCGGGCAGAGATACAGCTTAGTAAACTCGAGTTTACTAAGCTGTATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-2387s1c1
Sequence:CCGGGCCACATCATTCTGACATCAACTCGAGTTGATGTCAGAATGATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-3150s1c1
Sequence:CCGGGCCAATGTAAACACTTGGAATCTCGAGATTCCAAGTGTTTACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-286s1c1
Sequence:CCGGGCCCTGGAACTGTTAAAGATACTCGAGTATCTTTAACAGTTCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-734s1c1
Sequence:CCGGGCCTCATTTCTCCGGTTACAACTCGAGTTGTAACCGGAGAAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013584
VALIDATED
LIFR MISSION shRNA shRNA Plasmid DNA
leukemia inhibitory factor receptor alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-1836s1c1
Sequence:CCGGGCAGAGATACAGCTTAGTAAACTCGAGTTTACTAAGCTGTATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-2387s1c1
Sequence:CCGGGCCACATCATTCTGACATCAACTCGAGTTGATGTCAGAATGATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-3150s1c1
Sequence:CCGGGCCAATGTAAACACTTGGAATCTCGAGATTCCAAGTGTTTACATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-286s1c1
Sequence:CCGGGCCCTGGAACTGTTAAAGATACTCGAGTATCTTTAACAGTTCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-734s1c1
Sequence:CCGGGCCTCATTTCTCCGGTTACAACTCGAGTTGTAACCGGAGAAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013584
VALIDATED
LIFR MISSION shRNA Lentiviral Transduction Particles
leukemia inhibitory factor receptor alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-1836s1c1
Sequence:CCGGGCAGAGATACAGCTTAGTAAACTCGAGTTTACTAAGCTGTATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-2387s1c1
Sequence:CCGGGCCACATCATTCTGACATCAACTCGAGTTGATGTCAGAATGATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-3150s1c1
Sequence:CCGGGCCAATGTAAACACTTGGAATCTCGAGATTCCAAGTGTTTACATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-286s1c1
Sequence:CCGGGCCCTGGAACTGTTAAAGATACTCGAGTATCTTTAACAGTTCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013584.1-734s1c1
Sequence:CCGGGCCTCATTTCTCCGGTTACAACTCGAGTTGTAACCGGAGAAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)