EMAIL THIS PAGE TO A FRIEND

LIG1

ligase I, DNA, ATP-dependent

83 Gene Product Result for
UniProtKB ID: P18858, B2RAI8, Q32P23
Gene ID:
Human(3978) Summary: LIG1 encodes DNA ligase I, with functions in DNA replication and the base excision repair process. Mutations in LIG1 that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. [provided by RefSeq, Jul 2008]
Mouse(16881) ligase I, DNA, ATP-dependent
Rat(81513) ligase I, DNA, ATP-dependent
Thale Cress(837333) DNA ligase 1
dog(100686967) ligase I, DNA, ATP-dependent
domestic cat(101093313) ligase I, DNA, ATP-dependent
cow(100124507) ligase I, DNA, ATP-dependent
Horse(100053186) ligase I, DNA, ATP-dependent
chicken(430516) ligase I, DNA, ATP-dependent
domestic guinea pig(100734013) ligase I, DNA, ATP-dependent
naked mole-rat(101702301) ligase I, DNA, ATP-dependent
sheep(101104173) ligase I, DNA, ATP-dependent
Domestic Rabbit(100340979) ligase I, DNA, ATP-dependent
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000234 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000234 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000234 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000234 Rosetta Predictions human pricing
NM_001024268 Rosetta Predictions rat pricing
NM_030855 Rosetta Predictions rat pricing
NM_001083188 Rosetta Predictions mouse pricing
NM_010715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209050 predicted 1792
2 SASI_Hs02_00302144 predicted 905
3 SASI_Hs01_00209051 predicted 930
4 SASI_Hs01_00209052 predicted 2586
5 SASI_Hs01_00209054 predicted 2817
6 SASI_Hs01_00209055 predicted 1431
7 SASI_Hs01_00209056 predicted 215
8 SASI_Hs01_00209057 predicted 2825
9 SASI_Hs01_00209059 predicted 2705
10 SASI_Hs02_00302145 predicted 1906
11 SASI_Hs01_00209053 predicted 2496
12 SASI_Hs01_00209058 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099023 predicted 1601
2 SASI_Rn01_00099024 predicted 1429
3 SASI_Rn01_00099025 predicted 2070
4 SASI_Rn01_00099026 predicted 537
5 SASI_Rn01_00099027 predicted 1401
6 SASI_Rn01_00099028 predicted 2317
7 SASI_Rn01_00099029 predicted 2246
8 SASI_Rn01_00099030 predicted 1603
9 SASI_Rn01_00099031 predicted 524
10 SASI_Rn02_00202444 predicted 2734
11 SASI_Rn01_00099022 predicted 2092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085528 predicted 1642
2 SASI_Rn01_00085530 predicted 1478
3 SASI_Rn01_00085531 predicted 2124
4 SASI_Rn01_00085532 predicted 1448
5 SASI_Rn01_00085533 predicted 2362
6 SASI_Rn01_00085534 predicted 2283
7 SASI_Rn02_00264099 predicted 1650
8 SASI_Rn01_00085535 predicted 2693
9 SASI_Rn02_00264100 predicted 2681
10 SASI_Rn01_00085536 predicted 572
11 SASI_Rn01_00085527 predicted 2133
12 SASI_Rn01_00085529 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299544 predicted 1570
2 SASI_Mm02_00299545 predicted 1528
3 SASI_Mm02_00299546 predicted 1725
4 SASI_Mm02_00299547 predicted 1449
5 SASI_Mm02_00299548 predicted 2036
6 SASI_Mm02_00299549 predicted 2613
7 SASI_Mm02_00299550 predicted 2055
8 SASI_Mm02_00299551 predicted 2204
9 SASI_Mm02_00299552 predicted 2435
10 SASI_Mm02_00299553 predicted 2875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030299 predicted 1499
2 SASI_Mm01_00030300 predicted 1448
3 SASI_Mm01_00030301 predicted 1648
4 SASI_Mm01_00030302 predicted 1378
5 SASI_Mm01_00030304 predicted 1968
6 SASI_Mm02_00319183 predicted 2537
7 SASI_Mm01_00030306 predicted 1973
8 SASI_Mm01_00030307 predicted 2128
9 SASI_Mm02_00319184 predicted 2358
10 SASI_Mm02_00319185 predicted 2802
11 SASI_Mm01_00030303 predicted 1270
12 SASI_Mm01_00030305 predicted 2192
13 SASI_Mm01_00030308 predicted 2089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010715
VALIDATED
LIG1 MISSION shRNA Bacterial Glycerol Stock
ligase I, DNA, ATP-dependent
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-2918s1c1
Sequence:CCGGCGGTTCATTCGTGTCCGTAAACTCGAGTTTACGGACACGAATGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-1175s1c1
Sequence:CCGGGCCCGGACATTTGAGAAGATTCTCGAGAATCTTCTCAAATGTCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-1100s1c1
Sequence:CCGGCCTTCCAAGAATAACTATCATCTCGAGATGATAGTTATTCTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-2475s1c1
Sequence:CCGGCCTTGGATGTTGATGCCACTTCTCGAGAAGTGGCATCAACATCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010715.1-445s1c1
Sequence:CCGGCGAGAGTGATTCTCCAGTGAACTCGAGTTCACTGGAGAATCACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-2362s21c1
Sequence:CCGGCCTTGGATGTTGATGCCACTTCTCGAGAAGTGGCATCAACATCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-1062s21c1
Sequence:CCGGGCCCGGACATTTGAGAAGATTCTCGAGAATCTTCTCAAATGTCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-2805s21c1
Sequence:CCGGCGGTTCATTCGTGTCCGTAAACTCGAGTTTACGGACACGAATGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-332s21c1
Sequence:CCGGCGAGAGTGATTCTCCAGTGAACTCGAGTTCACTGGAGAATCACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010715
VALIDATED
LIG1 MISSION shRNA shRNA Plasmid DNA
ligase I, DNA, ATP-dependent
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-2918s1c1
Sequence:CCGGCGGTTCATTCGTGTCCGTAAACTCGAGTTTACGGACACGAATGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-1175s1c1
Sequence:CCGGGCCCGGACATTTGAGAAGATTCTCGAGAATCTTCTCAAATGTCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-1100s1c1
Sequence:CCGGCCTTCCAAGAATAACTATCATCTCGAGATGATAGTTATTCTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-2475s1c1
Sequence:CCGGCCTTGGATGTTGATGCCACTTCTCGAGAAGTGGCATCAACATCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010715.1-445s1c1
Sequence:CCGGCGAGAGTGATTCTCCAGTGAACTCGAGTTCACTGGAGAATCACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-2362s21c1
Sequence:CCGGCCTTGGATGTTGATGCCACTTCTCGAGAAGTGGCATCAACATCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-1062s21c1
Sequence:CCGGGCCCGGACATTTGAGAAGATTCTCGAGAATCTTCTCAAATGTCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-2805s21c1
Sequence:CCGGCGGTTCATTCGTGTCCGTAAACTCGAGTTTACGGACACGAATGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-332s21c1
Sequence:CCGGCGAGAGTGATTCTCCAGTGAACTCGAGTTCACTGGAGAATCACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010715
VALIDATED
LIG1 MISSION shRNA Lentiviral Transduction Particles
ligase I, DNA, ATP-dependent
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-2918s1c1
Sequence:CCGGCGGTTCATTCGTGTCCGTAAACTCGAGTTTACGGACACGAATGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-1175s1c1
Sequence:CCGGGCCCGGACATTTGAGAAGATTCTCGAGAATCTTCTCAAATGTCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-1100s1c1
Sequence:CCGGCCTTCCAAGAATAACTATCATCTCGAGATGATAGTTATTCTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010715.1-2475s1c1
Sequence:CCGGCCTTGGATGTTGATGCCACTTCTCGAGAAGTGGCATCAACATCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010715.1-445s1c1
Sequence:CCGGCGAGAGTGATTCTCCAGTGAACTCGAGTTCACTGGAGAATCACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-2362s21c1
Sequence:CCGGCCTTGGATGTTGATGCCACTTCTCGAGAAGTGGCATCAACATCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-1062s21c1
Sequence:CCGGGCCCGGACATTTGAGAAGATTCTCGAGAATCTTCTCAAATGTCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-2805s21c1
Sequence:CCGGCGGTTCATTCGTGTCCGTAAACTCGAGTTTACGGACACGAATGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010715.2-332s21c1
Sequence:CCGGCGAGAGTGATTCTCCAGTGAACTCGAGTTCACTGGAGAATCACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000234
LIG1 MISSION shRNA Bacterial Glycerol Stock
ligase I, DNA, ATP-dependent
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-922s1c1
Sequence:CCGGCCTGCCAAGAACAACTATCATCTCGAGATGATAGTTGTTCTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-2740s1c1
Sequence:CCGGCGGTTTATTCGAGTCCGTGAACTCGAGTTCACGGACTCGAATAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-1738s1c1
Sequence:CCGGCTGAAACCAATGTTGGCCCATCTCGAGATGGGCCAACATTGGTTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-152s1c1
Sequence:CCGGCCAAGAAAGAGGGTAAAGCAACTCGAGTTGCTTTACCCTCTTTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-2346s1c1
Sequence:CCGGGCTCAAGCTGAAGAAGGACTACTCGAGTAGTCCTTCTTCAGCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-1801s21c1
Sequence:CCGGGCAGCTTTCACCTGCGAATACCTCGAGGTATTCGCAGGTGAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-2810s21c1
Sequence:CCGGACCGGAAGCAAAGTCAGATTCCTCGAGGAATCTGACTTTGCTTCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-2249s21c1
Sequence:CCGGTCCTGGAGCAGTCAGTGAAAGCTCGAGCTTTCACTGACTGCTCCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000234
LIG1 MISSION shRNA shRNA Plasmid DNA
ligase I, DNA, ATP-dependent
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-922s1c1
Sequence:CCGGCCTGCCAAGAACAACTATCATCTCGAGATGATAGTTGTTCTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-2740s1c1
Sequence:CCGGCGGTTTATTCGAGTCCGTGAACTCGAGTTCACGGACTCGAATAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-1738s1c1
Sequence:CCGGCTGAAACCAATGTTGGCCCATCTCGAGATGGGCCAACATTGGTTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-152s1c1
Sequence:CCGGCCAAGAAAGAGGGTAAAGCAACTCGAGTTGCTTTACCCTCTTTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-2346s1c1
Sequence:CCGGGCTCAAGCTGAAGAAGGACTACTCGAGTAGTCCTTCTTCAGCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-1801s21c1
Sequence:CCGGGCAGCTTTCACCTGCGAATACCTCGAGGTATTCGCAGGTGAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-2810s21c1
Sequence:CCGGACCGGAAGCAAAGTCAGATTCCTCGAGGAATCTGACTTTGCTTCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-2249s21c1
Sequence:CCGGTCCTGGAGCAGTCAGTGAAAGCTCGAGCTTTCACTGACTGCTCCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000234
LIG1 MISSION shRNA Lentiviral Transduction Particles
ligase I, DNA, ATP-dependent
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-922s1c1
Sequence:CCGGCCTGCCAAGAACAACTATCATCTCGAGATGATAGTTGTTCTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-2740s1c1
Sequence:CCGGCGGTTTATTCGAGTCCGTGAACTCGAGTTCACGGACTCGAATAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-1738s1c1
Sequence:CCGGCTGAAACCAATGTTGGCCCATCTCGAGATGGGCCAACATTGGTTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-152s1c1
Sequence:CCGGCCAAGAAAGAGGGTAAAGCAACTCGAGTTGCTTTACCCTCTTTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000234.1-2346s1c1
Sequence:CCGGGCTCAAGCTGAAGAAGGACTACTCGAGTAGTCCTTCTTCAGCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-1801s21c1
Sequence:CCGGGCAGCTTTCACCTGCGAATACCTCGAGGTATTCGCAGGTGAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-2810s21c1
Sequence:CCGGACCGGAAGCAAAGTCAGATTCCTCGAGGAATCTGACTTTGCTTCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000234.1-2249s21c1
Sequence:CCGGTCCTGGAGCAGTCAGTGAAAGCTCGAGCTTTCACTGACTGCTCCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)