EMAIL THIS PAGE TO A FRIEND

LIG3

ligase III, DNA, ATP-dependent

81 Gene Product Result for
Synonyms: LIG2
UniProtKB ID: P49916, Q16714, Q6NVK3
Gene ID:
Human(3980) Summary: This gene is a member of the DNA ligase family. Each member of this family encodes a protein that catalyzes the joining of DNA ends but they each have a distinct role in DNA metabolism. The protein encoded by this gene is involved in excision repair and is located in both the mitochondria and nucleus, with translation initiation from the upstream start codon allowing for transport to the mitochondria and translation initiation from a downstream start codon allowing for transport to the nucleus. Additionally, alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(16882) ligase III, DNA, ATP-dependent
Rat(303369) ligase III, DNA, ATP-dependent
sheep(101113866) ligase III, DNA, ATP-dependent
Domestic Rabbit(100344941) ligase III, DNA, ATP-dependent
domestic guinea pig(100716163) ligase III, DNA, ATP-dependent
naked mole-rat(101701011) ligase III, DNA, ATP-dependent
Zebrafish(563276) ligase III, DNA, ATP-dependent
cow(514719) ligase III, DNA, ATP-dependent
Horse(100071671) ligase III, DNA, ATP-dependent
domestic cat(101097931) ligase III, DNA, ATP-dependent
dog(491145) ligase III, DNA, ATP-dependent
chicken(417530) ligase III, DNA, ATP-dependent
fruit fly(41518) DNA ligase III
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304945 ANTI-LIG3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2700263 Anti-LIG3 (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution hamster, human
immunofluorescence, western blot pricing
HPA006723 Anti-LIG3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2700261 Anti-LIG3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107087 Anti-LIG3 antibody produced in rabbit affinity isolated antibody bovine, rabbit, mouse, dog, horse, rat, human, guinea pig
western blot pricing
SAB2107088 Anti-LIG3 antibody produced in rabbit affinity isolated antibody pig, mouse, rabbit, rat, horse, dog, human
western blot pricing
SAB2702141 Monoclonal Anti-LIG3 antibody produced in mouse clone 1F3 human, chicken, mouse
immunocytochemistry, immunofluorescence, immunoprecipitation (IP), proximity ligation assay, western blot pricing
SAB2702142 Monoclonal Anti-LIG3 antibody produced in mouse human
immunocytochemistry, immunofluorescence, western blot pricing
SAB2702143 Monoclonal Anti-LIG3 antibody produced in mouse human, mouse
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010716 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010716 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010716 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002311 Rosetta Predictions human pricing
NM_013975 Rosetta Predictions human pricing
NM_001012011 Rosetta Predictions rat pricing
XM_573160 Rosetta Predictions rat pricing
NM_010716 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135794 predicted 1158
2 SASI_Hs02_00333628 predicted 1909
3 SASI_Hs01_00135795 predicted 1707
4 SASI_Hs01_00135796 predicted 1318
5 SASI_Hs01_00135797 predicted 2479
6 SASI_Hs01_00135798 predicted 1053
7 SASI_Hs01_00135799 predicted 1308
8 SASI_Hs01_00135801 predicted 1336
9 SASI_Hs01_00135802 predicted 289
10 SASI_Hs01_00135803 predicted 1864
11 SASI_Hs01_00135800 predicted 2000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215467 predicted 1157
2 SASI_Hs02_00344922 predicted 1907
3 SASI_Hs01_00215468 predicted 1708
4 SASI_Hs01_00215469 predicted 1316
5 SASI_Hs01_00215470 predicted 2482
6 SASI_Hs01_00215471 predicted 1054
7 SASI_Hs01_00215472 predicted 1316
8 SASI_Hs01_00215474 predicted 1335
9 SASI_Hs01_00215475 predicted 292
10 SASI_Hs01_00215476 predicted 1862
11 SASI_Hs01_00215473 predicted 2006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067469 predicted 2952
2 SASI_Rn01_00067470 predicted 1732
3 SASI_Rn02_00200091 predicted 2336
4 SASI_Rn01_00067471 predicted 1313
5 SASI_Rn01_00067472 predicted 2780
6 SASI_Rn01_00067473 predicted 1303
7 SASI_Rn02_00200092 predicted 1027
8 SASI_Rn01_00067474 predicted 1753
9 SASI_Rn01_00067475 predicted 854
10 SASI_Rn01_00067476 predicted 782
11 SASI_Rn01_00067477 predicted 1845
12 SASI_Rn01_00067478 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127045 predicted 2963
2 SASI_Rn01_00127046 predicted 1747
3 SASI_Rn01_00127047 predicted 1317
4 SASI_Rn01_00127048 predicted 2791
5 SASI_Rn01_00127049 predicted 1301
6 SASI_Rn01_00127050 predicted 1766
7 SASI_Rn01_00127051 predicted 862
8 SASI_Rn01_00127052 predicted 788
9 SASI_Rn01_00127053 predicted 1849
10 SASI_Rn01_00127054 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010716 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145067 predicted 1364
2 SASI_Mm01_00145068 predicted 1096
3 SASI_Mm01_00145069 predicted 2979
4 SASI_Mm02_00319186 predicted 547
5 SASI_Mm02_00319187 predicted 3274
6 SASI_Mm01_00145070 predicted 2882
7 SASI_Mm02_00319188 predicted 224
8 SASI_Mm01_00145072 predicted 1905
9 SASI_Mm01_00145073 predicted 994
10 SASI_Mm01_00145074 predicted 3218
11 SASI_Mm01_00145066 predicted 3150
12 SASI_Mm01_00145071 predicted 3183
13 SASI_Mm01_00145075 predicted 2013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002311
VALIDATED
LIG3 MISSION shRNA Bacterial Glycerol Stock
ligase III, DNA, ATP-dependent
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002311.3-1723s21c1
Sequence:CCGGGCCCACTTTAAGGACTACATTCTCGAGAATGTAGTCCTTAAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002311.3-1986s21c1
Sequence:CCGGCCGGATCATGTTCTCAGAAATCTCGAGATTTCTGAGAACATGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-1677s1c1
Sequence:CCGGGCCCACTTTAAGGACTACATTCTCGAGAATGTAGTCCTTAAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-2685s1c1
Sequence:CCGGGCCAGTACCAAGAAAGCAGAACTCGAGTTCTGCTTTCTTGGTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-997s1c1
Sequence:CCGGCAGGAGTCATTAAGACTGTTTCTCGAGAAACAGTCTTAATGACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-2711s1c1
Sequence:CCGGGCTGAGTAACTCCAACAGCAACTCGAGTTGCTGTTGGAGTTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-1940s1c1
Sequence:CCGGCCGGATCATGTTCTCAGAAATCTCGAGATTTCTGAGAACATGATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-2757s21c1
Sequence:CCGGGCTGAGTAACTCCAACAGCAACTCGAGTTGCTGTTGGAGTTACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-2731s21c1
Sequence:CCGGGCCAGTACCAAGAAAGCAGAACTCGAGTTCTGCTTTCTTGGTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-1043s21c1
Sequence:CCGGCAGGAGTCATTAAGACTGTTTCTCGAGAAACAGTCTTAATGACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002311
VALIDATED
LIG3 MISSION shRNA shRNA Plasmid DNA
ligase III, DNA, ATP-dependent
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002311.3-1723s21c1
Sequence:CCGGGCCCACTTTAAGGACTACATTCTCGAGAATGTAGTCCTTAAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002311.3-1986s21c1
Sequence:CCGGCCGGATCATGTTCTCAGAAATCTCGAGATTTCTGAGAACATGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-1677s1c1
Sequence:CCGGGCCCACTTTAAGGACTACATTCTCGAGAATGTAGTCCTTAAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-2685s1c1
Sequence:CCGGGCCAGTACCAAGAAAGCAGAACTCGAGTTCTGCTTTCTTGGTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-997s1c1
Sequence:CCGGCAGGAGTCATTAAGACTGTTTCTCGAGAAACAGTCTTAATGACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-2711s1c1
Sequence:CCGGGCTGAGTAACTCCAACAGCAACTCGAGTTGCTGTTGGAGTTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-1940s1c1
Sequence:CCGGCCGGATCATGTTCTCAGAAATCTCGAGATTTCTGAGAACATGATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-2757s21c1
Sequence:CCGGGCTGAGTAACTCCAACAGCAACTCGAGTTGCTGTTGGAGTTACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-2731s21c1
Sequence:CCGGGCCAGTACCAAGAAAGCAGAACTCGAGTTCTGCTTTCTTGGTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-1043s21c1
Sequence:CCGGCAGGAGTCATTAAGACTGTTTCTCGAGAAACAGTCTTAATGACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002311
VALIDATED
LIG3 MISSION shRNA Lentiviral Transduction Particles
ligase III, DNA, ATP-dependent
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002311.3-1723s21c1
Sequence:CCGGGCCCACTTTAAGGACTACATTCTCGAGAATGTAGTCCTTAAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002311.3-1986s21c1
Sequence:CCGGCCGGATCATGTTCTCAGAAATCTCGAGATTTCTGAGAACATGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-1677s1c1
Sequence:CCGGGCCCACTTTAAGGACTACATTCTCGAGAATGTAGTCCTTAAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-2685s1c1
Sequence:CCGGGCCAGTACCAAGAAAGCAGAACTCGAGTTCTGCTTTCTTGGTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-997s1c1
Sequence:CCGGCAGGAGTCATTAAGACTGTTTCTCGAGAAACAGTCTTAATGACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-2711s1c1
Sequence:CCGGGCTGAGTAACTCCAACAGCAACTCGAGTTGCTGTTGGAGTTACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002311.2-1940s1c1
Sequence:CCGGCCGGATCATGTTCTCAGAAATCTCGAGATTTCTGAGAACATGATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-2757s21c1
Sequence:CCGGGCTGAGTAACTCCAACAGCAACTCGAGTTGCTGTTGGAGTTACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-2731s21c1
Sequence:CCGGGCCAGTACCAAGAAAGCAGAACTCGAGTTCTGCTTTCTTGGTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002311.3-1043s21c1
Sequence:CCGGCAGGAGTCATTAAGACTGTTTCTCGAGAAACAGTCTTAATGACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010716
VALIDATED
LIG3 MISSION shRNA Bacterial Glycerol Stock
ligase III, DNA, ATP-dependent
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-2963s1c1
Sequence:CCGGCCAGACTTCAAACGTCTCAAACTCGAGTTTGAGACGTTTGAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-2791s21c1
Sequence:CCGGCCACCGAACAGAAGCTCAATACTCGAGTATTGAGCTTCTGTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-1635s21c1
Sequence:CCGGGCAATGAAGAAGTGTCCCAATCTCGAGATTGGGACACTTCTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010716.1-731s1c1
Sequence:CCGGCCAGTGAAAGGTGCTTCGTTTCTCGAGAAACGAAGCACCTTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-2751s1c1
Sequence:CCGGCCACCGAACAGAAGCTCAATACTCGAGTATTGAGCTTCTGTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-1159s1c1
Sequence:CCGGCGTGTCAGAGACGATCAGAATCTCGAGATTCTGATCGTCTCTGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-1592s1c1
Sequence:CCGGGCAATGAAGAAGTGTCCCAATCTCGAGATTGGGACACTTCTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-1199s21c1
Sequence:CCGGCGTGTCAGAGACGATCAGAATCTCGAGATTCTGATCGTCTCTGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-3003s21c1
Sequence:CCGGCCAGACTTCAAACGTCTCAAACTCGAGTTTGAGACGTTTGAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-780s21c1
Sequence:CCGGCCAGTGAAAGGTGCTTCGTTTCTCGAGAAACGAAGCACCTTTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010716
VALIDATED
LIG3 MISSION shRNA shRNA Plasmid DNA
ligase III, DNA, ATP-dependent
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-2963s1c1
Sequence:CCGGCCAGACTTCAAACGTCTCAAACTCGAGTTTGAGACGTTTGAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-2791s21c1
Sequence:CCGGCCACCGAACAGAAGCTCAATACTCGAGTATTGAGCTTCTGTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-1635s21c1
Sequence:CCGGGCAATGAAGAAGTGTCCCAATCTCGAGATTGGGACACTTCTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010716.1-731s1c1
Sequence:CCGGCCAGTGAAAGGTGCTTCGTTTCTCGAGAAACGAAGCACCTTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-2751s1c1
Sequence:CCGGCCACCGAACAGAAGCTCAATACTCGAGTATTGAGCTTCTGTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-1159s1c1
Sequence:CCGGCGTGTCAGAGACGATCAGAATCTCGAGATTCTGATCGTCTCTGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-1592s1c1
Sequence:CCGGGCAATGAAGAAGTGTCCCAATCTCGAGATTGGGACACTTCTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-1199s21c1
Sequence:CCGGCGTGTCAGAGACGATCAGAATCTCGAGATTCTGATCGTCTCTGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-3003s21c1
Sequence:CCGGCCAGACTTCAAACGTCTCAAACTCGAGTTTGAGACGTTTGAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-780s21c1
Sequence:CCGGCCAGTGAAAGGTGCTTCGTTTCTCGAGAAACGAAGCACCTTTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010716
VALIDATED
LIG3 MISSION shRNA Lentiviral Transduction Particles
ligase III, DNA, ATP-dependent
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-2963s1c1
Sequence:CCGGCCAGACTTCAAACGTCTCAAACTCGAGTTTGAGACGTTTGAAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-2791s21c1
Sequence:CCGGCCACCGAACAGAAGCTCAATACTCGAGTATTGAGCTTCTGTTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-1635s21c1
Sequence:CCGGGCAATGAAGAAGTGTCCCAATCTCGAGATTGGGACACTTCTTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010716.1-731s1c1
Sequence:CCGGCCAGTGAAAGGTGCTTCGTTTCTCGAGAAACGAAGCACCTTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-2751s1c1
Sequence:CCGGCCACCGAACAGAAGCTCAATACTCGAGTATTGAGCTTCTGTTCGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-1159s1c1
Sequence:CCGGCGTGTCAGAGACGATCAGAATCTCGAGATTCTGATCGTCTCTGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010716.1-1592s1c1
Sequence:CCGGGCAATGAAGAAGTGTCCCAATCTCGAGATTGGGACACTTCTTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-1199s21c1
Sequence:CCGGCGTGTCAGAGACGATCAGAATCTCGAGATTCTGATCGTCTCTGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-3003s21c1
Sequence:CCGGCCAGACTTCAAACGTCTCAAACTCGAGTTTGAGACGTTTGAAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010716.2-780s21c1
Sequence:CCGGCCAGTGAAAGGTGCTTCGTTTCTCGAGAAACGAAGCACCTTTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)