EMAIL THIS PAGE TO A FRIEND

LIG4

ligase IV, DNA, ATP-dependent

80 Gene Product Result for
UniProtKB ID: P49917, Q8IY66, Q8TEU5
Gene ID:
Human(3981) Summary: The protein encoded by this gene is a DNA ligase that joins single-strand breaks in a double-stranded polydeoxynucleotide in an ATP-dependent reaction. This protein is essential for V(D)J recombination and DNA double-strand break (DSB) repair through nonhomologous end joining (NHEJ). This protein forms a complex with the X-ray repair cross complementing protein 4 (XRCC4), and further interacts with the DNA-dependent protein kinase (DNA-PK). Both XRCC4 and DNA-PK are known to be required for NHEJ. The crystal structure of the complex formed by this protein and XRCC4 has been resolved. Defects in this gene are the cause of LIG4 syndrome. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Mouse(319583) ligase IV, DNA, ATP-dependent
Rat(290907) ligase IV, DNA, ATP-dependent
Zebrafish(569525) ligase IV, DNA, ATP-dependent
cow(781252) ligase IV, DNA, ATP-dependent
Horse(100051479) ligase IV, DNA, ATP-dependent
domestic cat(101087961) ligase IV, DNA, ATP-dependent
dog(485544) ligase IV, DNA, ATP-dependent
chicken(418764) ligase IV, DNA, ATP-dependent
domestic guinea pig(100719171) ligase IV, DNA, ATP-dependent
naked mole-rat(101722009) ligase IV, DNA, ATP-dependent
sheep(101116239) ligase IV, DNA, ATP-dependent
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098268 Rosetta Predictions human pricing
NM_002312 Rosetta Predictions human pricing
NM_206937 Rosetta Predictions human pricing
NM_001106095 Rosetta Predictions rat pricing
NM_176953 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318748 predicted 1074
2 SASI_Hs02_00318749 predicted 488
3 SASI_Hs02_00318750 predicted 1864
4 SASI_Hs02_00318751 predicted 2665
5 SASI_Hs02_00318752 predicted 651
6 SASI_Hs02_00318753 predicted 2328
7 SASI_Hs02_00318754 predicted 1103
8 SASI_Hs02_00318755 predicted 978
9 SASI_Hs02_00318756 predicted 1027
10 SASI_Hs02_00318757 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198479 predicted 1116
2 SASI_Hs02_00333629 predicted 524
3 SASI_Hs01_00198480 predicted 1907
4 SASI_Hs01_00198481 predicted 2705
5 SASI_Hs01_00198482 predicted 693
6 SASI_Hs01_00198484 predicted 2367
7 SASI_Hs01_00198485 predicted 1144
8 SASI_Hs01_00198487 predicted 1021
9 SASI_Hs02_00333630 predicted 1064
10 SASI_Hs01_00198488 predicted 1499
11 SASI_Hs01_00198483 predicted 1920
12 SASI_Hs01_00198486 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084840 predicted 990
2 SASI_Hs02_00373635 predicted 407
3 SASI_Hs01_00084841 predicted 1784
4 SASI_Hs01_00084842 predicted 2583
5 SASI_Hs01_00084843 predicted 573
6 SASI_Hs01_00084845 predicted 2246
7 SASI_Hs01_00084846 predicted 1018
8 SASI_Hs01_00084848 predicted 895
9 SASI_Hs02_00373636 predicted 944
10 SASI_Hs01_00084849 predicted 1377
11 SASI_Hs01_00084844 predicted 1800
12 SASI_Hs01_00084847 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215582 predicted 554
2 SASI_Rn02_00215583 predicted 2741
3 SASI_Rn02_00215584 predicted 1401
4 SASI_Rn02_00215585 predicted 730
5 SASI_Rn02_00215586 predicted 708
6 SASI_Rn02_00215587 predicted 854
7 SASI_Rn02_00215588 predicted 2675
8 SASI_Rn02_00215589 predicted 2368
9 SASI_Rn02_00215590 predicted 2707
10 SASI_Rn02_00215591 predicted 2583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046154 predicted 2149
2 SASI_Mm01_00046155 predicted 1458
3 SASI_Mm01_00046156 predicted 2775
4 SASI_Mm01_00046157 predicted 2078
5 SASI_Mm01_00046158 predicted 2647
6 SASI_Mm01_00046160 predicted 1422
7 SASI_Mm01_00046161 predicted 2418
8 SASI_Mm01_00046162 predicted 2704
9 SASI_Mm01_00046163 predicted 2807
10 SASI_Mm02_00346839 predicted 2624
11 SASI_Mm01_00046159 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002312
VALIDATED
LIG4 MISSION shRNA Bacterial Glycerol Stock
ligase IV, DNA, ATP-dependent
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-2550s21c1
Sequence:CCGGTTGCTATGGTGATAGTTATTTCTCGAGAAATAACTATCACCATAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-1223s21c1
Sequence:GTACCGGATGCATTCAAAGCAGATATACCTCGAGGTATATCTGCTTTGAATGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-2711s21c1
Sequence:CCGGTTCGACGCCACACCGTTTATTCTCGAGAATAAACGGTGTGGCGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2662s1c1
Sequence:CCGGGCTGATTTAGAATATCGGTATCTCGAGATACCGATATTCTAAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002312.3-3939s21c1
Sequence:CCGGGCCTATCTCATGACCATATTGCTCGAGCAATATGGTCATGAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-1261s21c1
Sequence:CCGGGGTGAGATGATGGCCTATAATCTCGAGATTATAGGCCATCATCTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2536s1c1
Sequence:CCGGGCCCGTGAATATGATTGCTATCTCGAGATAGCAATCATATTCACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2100s1c1
Sequence:CCGGGCTCGCATCTAAACACCTTTACTCGAGTAAAGGTGTTTAGATGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002312.x-1633s1c1
Sequence:CCGGTATGTCAGTGGACTAATGGATCTCGAGATCCATTAGTCCACTGACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.x-2729s1c1
Sequence:CCGGATTTGGACTCGTATGCTGTTACTCGAGTAACAGCATACGAGTCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002312.2-3011s1c1
Sequence:CCGGGCTAGGTTTCCTAGTGAGGAACTCGAGTTCCTCACTAGGAAACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-739s1c1
Sequence:CCGGGCCAGCAATAATTCTGCTAAACTCGAGTTTAGCAGAATTATTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002312
VALIDATED
LIG4 MISSION shRNA shRNA Plasmid DNA
ligase IV, DNA, ATP-dependent
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-2550s21c1
Sequence:CCGGTTGCTATGGTGATAGTTATTTCTCGAGAAATAACTATCACCATAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-1223s21c1
Sequence:GTACCGGATGCATTCAAAGCAGATATACCTCGAGGTATATCTGCTTTGAATGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-2711s21c1
Sequence:CCGGTTCGACGCCACACCGTTTATTCTCGAGAATAAACGGTGTGGCGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2662s1c1
Sequence:CCGGGCTGATTTAGAATATCGGTATCTCGAGATACCGATATTCTAAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002312.3-3939s21c1
Sequence:CCGGGCCTATCTCATGACCATATTGCTCGAGCAATATGGTCATGAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-1261s21c1
Sequence:CCGGGGTGAGATGATGGCCTATAATCTCGAGATTATAGGCCATCATCTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2536s1c1
Sequence:CCGGGCCCGTGAATATGATTGCTATCTCGAGATAGCAATCATATTCACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2100s1c1
Sequence:CCGGGCTCGCATCTAAACACCTTTACTCGAGTAAAGGTGTTTAGATGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002312.x-1633s1c1
Sequence:CCGGTATGTCAGTGGACTAATGGATCTCGAGATCCATTAGTCCACTGACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.x-2729s1c1
Sequence:CCGGATTTGGACTCGTATGCTGTTACTCGAGTAACAGCATACGAGTCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002312.2-3011s1c1
Sequence:CCGGGCTAGGTTTCCTAGTGAGGAACTCGAGTTCCTCACTAGGAAACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-739s1c1
Sequence:CCGGGCCAGCAATAATTCTGCTAAACTCGAGTTTAGCAGAATTATTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002312
VALIDATED
LIG4 MISSION shRNA Lentiviral Transduction Particles
ligase IV, DNA, ATP-dependent
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-2550s21c1
Sequence:CCGGTTGCTATGGTGATAGTTATTTCTCGAGAAATAACTATCACCATAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-1223s21c1
Sequence:GTACCGGATGCATTCAAAGCAGATATACCTCGAGGTATATCTGCTTTGAATGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-2711s21c1
Sequence:CCGGTTCGACGCCACACCGTTTATTCTCGAGAATAAACGGTGTGGCGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2662s1c1
Sequence:CCGGGCTGATTTAGAATATCGGTATCTCGAGATACCGATATTCTAAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002312.3-3939s21c1
Sequence:CCGGGCCTATCTCATGACCATATTGCTCGAGCAATATGGTCATGAGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002312.3-1261s21c1
Sequence:CCGGGGTGAGATGATGGCCTATAATCTCGAGATTATAGGCCATCATCTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2536s1c1
Sequence:CCGGGCCCGTGAATATGATTGCTATCTCGAGATAGCAATCATATTCACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-2100s1c1
Sequence:CCGGGCTCGCATCTAAACACCTTTACTCGAGTAAAGGTGTTTAGATGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002312.x-1633s1c1
Sequence:CCGGTATGTCAGTGGACTAATGGATCTCGAGATCCATTAGTCCACTGACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.x-2729s1c1
Sequence:CCGGATTTGGACTCGTATGCTGTTACTCGAGTAACAGCATACGAGTCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040003    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002312.2-3011s1c1
Sequence:CCGGGCTAGGTTTCCTAGTGAGGAACTCGAGTTCCTCACTAGGAAACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002312.2-739s1c1
Sequence:CCGGGCCAGCAATAATTCTGCTAAACTCGAGTTTAGCAGAATTATTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176953
LIG4 MISSION shRNA Bacterial Glycerol Stock
ligase IV, DNA, ATP-dependent
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2285s1c1
Sequence:CCGGGCCCGGATACATACTGTGTTACTCGAGTAACACAGTATGTATCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2696s1c1
Sequence:CCGGCCAGAATTGAAGCCACGAGATCTCGAGATCTCGTGGCTTCAATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-1398s1c1
Sequence:CCGGCCGCATAGAAATAGTGCAGAACTCGAGTTCTGCACTATTTCTATGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-629s1c1
Sequence:CCGGGCTTAACCATACAGCAGGTAACTCGAGTTACCTGCTGTATGGTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2629s1c1
Sequence:CCGGCCTCTCAGTATGTTTCGACATCTCGAGATGTCGAAACATACTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176953
LIG4 MISSION shRNA shRNA Plasmid DNA
ligase IV, DNA, ATP-dependent
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2285s1c1
Sequence:CCGGGCCCGGATACATACTGTGTTACTCGAGTAACACAGTATGTATCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2696s1c1
Sequence:CCGGCCAGAATTGAAGCCACGAGATCTCGAGATCTCGTGGCTTCAATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-1398s1c1
Sequence:CCGGCCGCATAGAAATAGTGCAGAACTCGAGTTCTGCACTATTTCTATGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-629s1c1
Sequence:CCGGGCTTAACCATACAGCAGGTAACTCGAGTTACCTGCTGTATGGTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2629s1c1
Sequence:CCGGCCTCTCAGTATGTTTCGACATCTCGAGATGTCGAAACATACTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176953
LIG4 MISSION shRNA Lentiviral Transduction Particles
ligase IV, DNA, ATP-dependent
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2285s1c1
Sequence:CCGGGCCCGGATACATACTGTGTTACTCGAGTAACACAGTATGTATCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2696s1c1
Sequence:CCGGCCAGAATTGAAGCCACGAGATCTCGAGATCTCGTGGCTTCAATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-1398s1c1
Sequence:CCGGCCGCATAGAAATAGTGCAGAACTCGAGTTCTGCACTATTTCTATGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-629s1c1
Sequence:CCGGGCTTAACCATACAGCAGGTAACTCGAGTTACCTGCTGTATGGTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176953.2-2629s1c1
Sequence:CCGGCCTCTCAGTATGTTTCGACATCTCGAGATGTCGAAACATACTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)