EMAIL THIS PAGE TO A FRIEND

LILRA1

leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1

62 Gene Product Result for
Synonyms: CD85I LIR-6 LIR6
Species: Human LILRA1(11024)
UniProtKB ID: O75019, O75018, Q3MJA6
Gene ID:
Human(11024) Summary: This gene encodes an activating member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein is predominantly expressed in B cells, interacts with major histocompatibility complex class I ligands, and contributes to the regulation of immune responses. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500197 Anti-LILRA1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB4300922 Anti-LILRA1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006863 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006863 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169753 predicted 452
2 SASI_Hs01_00169755 predicted 1661
3 SASI_Hs01_00169756 predicted 908
4 SASI_Hs01_00169757 predicted 1671
5 SASI_Hs01_00169758 predicted 462
6 SASI_Hs01_00169760 predicted 1749
7 SASI_Hs01_00169762 predicted 1744
8 SASI_Hs02_00342487 predicted 464
9 SASI_Hs02_00342488 predicted 1676
10 SASI_Hs02_00342489 predicted 1673
11 SASI_Hs01_00169754 predicted 354
12 SASI_Hs01_00169759 predicted 1415
13 SASI_Hs01_00169761 predicted 1744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006863
LILRA1 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006863.1-1677s21c1
Sequence:CCGGGAGAGAAGAATGTACCCTTCACTCGAGTGAAGGGTACATTCTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006863.1-1500s21c1
Sequence:CCGGGCTAACACCCTCAGCCCATCACTCGAGTGATGGGCTGAGGGTGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006863.1-1736s21c1
Sequence:CCGGGAGGTTCCGGGAGACAATTTACTCGAGTAAATTGTCTCCCGGAACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006863.1-917s21c1
Sequence:CCGGGTGTGTTTCTGATGTCAGCTACTCGAGTAGCTGACATCAGAAACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-401s1c1
Sequence:CCGGCCCACAGGAGATTGTGAAGAACTCGAGTTCTTCACAATCTCCTGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-1287s1c1
Sequence:CCGGCTCAGATCAATACACGAATATCTCGAGATATTCGTGTATTGATCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-1238s1c1
Sequence:CCGGCCACACTTTCCTTCTGACCAACTCGAGTTGGTCAGAAGGAAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-661s1c1
Sequence:CCGGGAGAAGATGAACACCCACAATCTCGAGATTGTGGGTGTTCATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-948s1c1
Sequence:CCGGGTTCTGTATAAGGAGGGAGAACTCGAGTTCTCCCTCCTTATACAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006863
LILRA1 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006863.1-1677s21c1
Sequence:CCGGGAGAGAAGAATGTACCCTTCACTCGAGTGAAGGGTACATTCTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006863.1-1500s21c1
Sequence:CCGGGCTAACACCCTCAGCCCATCACTCGAGTGATGGGCTGAGGGTGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006863.1-1736s21c1
Sequence:CCGGGAGGTTCCGGGAGACAATTTACTCGAGTAAATTGTCTCCCGGAACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006863.1-917s21c1
Sequence:CCGGGTGTGTTTCTGATGTCAGCTACTCGAGTAGCTGACATCAGAAACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-401s1c1
Sequence:CCGGCCCACAGGAGATTGTGAAGAACTCGAGTTCTTCACAATCTCCTGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-1287s1c1
Sequence:CCGGCTCAGATCAATACACGAATATCTCGAGATATTCGTGTATTGATCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-1238s1c1
Sequence:CCGGCCACACTTTCCTTCTGACCAACTCGAGTTGGTCAGAAGGAAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-661s1c1
Sequence:CCGGGAGAAGATGAACACCCACAATCTCGAGATTGTGGGTGTTCATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-948s1c1
Sequence:CCGGGTTCTGTATAAGGAGGGAGAACTCGAGTTCTCCCTCCTTATACAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006863
LILRA1 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006863.1-1677s21c1
Sequence:CCGGGAGAGAAGAATGTACCCTTCACTCGAGTGAAGGGTACATTCTTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006863.1-1500s21c1
Sequence:CCGGGCTAACACCCTCAGCCCATCACTCGAGTGATGGGCTGAGGGTGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006863.1-1736s21c1
Sequence:CCGGGAGGTTCCGGGAGACAATTTACTCGAGTAAATTGTCTCCCGGAACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006863.1-917s21c1
Sequence:CCGGGTGTGTTTCTGATGTCAGCTACTCGAGTAGCTGACATCAGAAACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-401s1c1
Sequence:CCGGCCCACAGGAGATTGTGAAGAACTCGAGTTCTTCACAATCTCCTGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-1287s1c1
Sequence:CCGGCTCAGATCAATACACGAATATCTCGAGATATTCGTGTATTGATCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-1238s1c1
Sequence:CCGGCCACACTTTCCTTCTGACCAACTCGAGTTGGTCAGAAGGAAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-661s1c1
Sequence:CCGGGAGAAGATGAACACCCACAATCTCGAGATTGTGGGTGTTCATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006863.1-948s1c1
Sequence:CCGGGTTCTGTATAAGGAGGGAGAACTCGAGTTCTCCCTCCTTATACAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)